Observation 62484: Peniophora malenconii Boidin & Lanq.
When: 2011-01-18
(38.0° -122.0° )

Notes: UC1860812 is the specimen # in UC Herbarium
This is a resupinate to effused-reflexed fungus with dark pseudocystidia, thick-walled incrusted cystidia, clamped hyphae, and allantoid spores. The genus is new to me, but is apparently a recent segregate from Peniophora. It was fruiting on dead coyote bush (Baccharis pilularis) stems.

It has been reported on coyote bush before from California and elsewhere in the southwest (see Chamuris 1987. Mycotaxon 28:543. This is where subsp. americana is described. Chamuris says it is weakly sulvo-vanilla positive, but I did not see this on the current specimen. He also calls the hyphal system monomitic, but being less experienced in such calls i would have called it dimitic because of the many thick-walled, hyphae with few septa.

Species Lists

Images

131597
131591
131592
Here is a closeup of the a thick-wall incrusted cystidium.
131593
These are the dark pseudocystidia
131594
spores are about 8 X 3 um
131595
pure white when spore printed onto a glass slide. This is different from most (all?) Peniophora that are faintly pinkish
131596
closeup of hymenium on sterioid fruitbodies
131598
This is a fully resupinate piece of the collection. The slightly gray-blue color was different enough that I originally treated it as a different collection.
131599
This was on the same stem as the sterioid form.
131600

Proposed Names

55% (1)
Used references: Fungi Europaei Corticiaceae s.l. & Mycotaxon28:543

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
hooray for crusts!
By: Danny Newman (myxomop)
2016-09-09 10:39:07 PDT (-0700)

i too would have called the last three images different. how did you ascertain that they are definitely all the same thing?

and an ITS sequence
By: Tom Bruns (pogon)
2014-04-10 13:15:54 PDT (-0700)

TCTTGGTCAATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGAAGTTCGGAATGCGTGTCCGCTGTTGACGCTGCCCAGCAATGGGATGTGCTCGCTCGGATGCGTGTCCCTTCACTATCCCACCCCATTGTGAACCAAGNGTGTGAGCCGAAGAGAGATCGGAGGCTCGCATGCAACCCTTAACATACCCCAATGAAGTANCAGAATGTACCTTGCGTTAACTCGCACAAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACGCCTGTTTGAGTGTCGTGAACTCCTCCANCCTCTACCTTTTTCGGAAGGCATTGGGCTGGGATTTGGGAGCTTGCGGGTCCCTGGTCGATCCGCTCTCCTTGAATACATTAGCGAAGCCCTTTGCGGCCTTGGTGTGATAATTATCTGCGCCTTGGCTTAGCGAACCTATAGGGACTTGCTTCCAACCGTCTCGCAAGAGACAACGACTACCAACTTGACCTCAAATCAGGCGGGACTACCCGCTGAACTTAAGCATATCAA

Very nice
By: Darvin DeShazer (darv)
2011-01-18 22:20:01 PST (-0800)

This is outstanding!

Created: 2011-01-18 17:33:59 PST (-0800)
Last modified: 2016-09-09 10:24:04 PDT (-0700)
Viewed: 302 times, last viewed: 2016-10-22 05:32:53 PDT (-0700)
Show Log