Observation 64864: Laricifomes officinalis (Batsch) Kotl. & Pouzar
When: 2011-02-12
Herbarium specimen reported

Notes: Same conk as http://mushroomobserver.org/63699
Univ. of CA, Berkley herbarium # UC1861067

Species Lists

Images

138918
Front side
138919
Back side
138920
Point of attachment to the tree
138921
Cracking of the pileus
138922
Chalky tubes that were pushed with a finger. They easily crumbled and broke apart.

Proposed Names

92% (2)
Eye3 Eyes3
Recognized by sight: Pileus surface cracking, tube trama malleable like putty becoming brittle, chalky and taste very, very bitter.
Based on microscopic features: Sclerids present

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
everybody has different sense perceptions…
By: Debbie Viess (amanitarita)
2011-05-10 22:23:55 CDT (-0400)

I believe that you tasted bitter, but I didn’t, even after repeating the experiment.

Still, it’s a very cool and dramatic polypore. That’s why I took it home with me, even after Bruns rejected it at our Fair. It has a definite Wow! factor.

It tasted bitter to me.
By: Glenn Walker (gwalker23)
2011-05-10 17:55:37 CDT (-0400)

I just want to add that while I was culturing this specimen (Thank you!), I couldn’t help taste a little piece. It was from the point of attachment to the tree, where some amber resiny material bubbled out when I inserted a hot boring tool to extract the culture. The resin looked like tree sap, so it is possible I tasted wood and/or fungus. It looked like fungus, grew what looked like a nice culture, and it was bitter as can be. It was probably the most bitter thing I’ve tasted in 10 years or more. It persisted for at least 30 minutes as Darvin explains. That doesn’t rule out the possibility that Stamets’ and the culture we took from this specimen are all some other fungus. The fruiting body was off the tree a month or more before we received it for culture. Interested to compare to the other sequences now.

Nice. Took it to the mat.
By: Christian (Christian Schwarz)
2011-05-09 23:39:56 CDT (-0400)
ITS matches 100% with a pair of sequences of Fomitopsis officinalis by Stamets
By: Darvin DeShazer (darv)
2011-05-09 22:40:07 CDT (-0400)

Strain Code: Lo-PRII (Aemtek Isolation No. 2117)
ITS Region Sequence:
AGGATCATTATTGAATTTTGAATGGGGTTGTAGCTGGCCTTCCGGGCATGTGCACGCCCCACTCATTCCA
AATTCTCATACACCTGTGCACATCCTGTAGGTTTGGTTTGAGTTGCGGTCTCTTCGCGGAGATTGCGGCT
CGGCCTTTCCTATGTTATATATAAACTCTATACAGTCTGCAGAATGTAAACCGCGTTTAACGCATTAAAT
ACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGT
GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCAT
GCCTGTTTGAGTGTCATGGAATTCTCAACCCCCATCACCTTTGTTGGTGGTGTGTGGGCTTGGATTTGGA
GGTTTTCTGCCGGACGGTCAAACGTTCGGCTCCTCTTGAATGCATTAGCTTGGACCTCTGTGTATCTTGC
TCAATCCGGTGTGATAGTTTTGTCTACGCTGGAGGGTTTACACTCTGTGAGGGTTTGGGCTTCCAATCGT
CCTTTCGGACAATTGTTTTTTTGACCTCTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATA
TCAATA

Mcllvaine
By: Charles Seltenright Sr (Shroomin Yooper)
2011-03-30 12:54:40 CDT (-0400)
Everyones taste are different
By: Charles Seltenright Sr (Shroomin Yooper)
2011-03-30 12:46:39 CDT (-0400)

Mcallvaine ate things that were borderline that earned him the name ‘’Ole Iron Guts’’And he noted alot of them as edible.Reading his writings and books are really cool in a historical perspective.

Bitter
By: Darvin DeShazer (darv)
2011-03-30 01:04:46 CDT (-0400)

Three people have tasted it here in Sebastopol and all three say it is bitter. I was spitting for 30 minutes until the taste finally left.

Bitter/chalky?
By: Robert Sasata (Sasata)
2011-03-28 17:00:17 CDT (-0400)

I thought Debbie claimed it wasn’t bitter or chalky?

Created: 2011-03-28 01:00:14 CDT (-0400)
Last modified: 2011-12-29 13:18:29 CST (-0500)
Viewed: 295 times, last viewed: 2016-11-27 21:11:25 CST (-0500)
Show Log