Observation 88084: Pholiotina smithii (Watling) Enderle 1999
When: 2011-08-09
Collection location: Sweden [Click for map]
Herbarium specimen reported

Notes: Macroscopic photos by knarkkorven. Micrographs by Alan Rockefeller.

From this thread.

Scale divisions 10.00 micrometers.

Spores (7.5) 7.7 – 8.9 (10.3) x (4.3) 4.4 – 4.8 (4.9) μm.

7.53 × 4.52
7.76 × 4.37
8.09 × 4.32
8.18 × 4.51
8.23 × 4.52
8.31 × 4.32
8.37 × 4.41
8.37 × 4.41
8.37 × 4.51
8.41 × 4.79
8.51 × 4.51
8.51 × 4.60
8.55 × 4.83
8.69 × 4.65
8.74 × 4.41
8.93 × 4.88
10.37 × 5.25

ITS1 sequence:

TATTGATATGCTTAAGTTCAGCGGGTAATCCTACCTGATTTGAGGTCAAAATGATCATTAAGTTGGTTGGCAGGGCCAAC
GGTTAGAAGCAGAGTCCCACTCAAAGGCTGTCGTCTGCATAGCGTAGATAATTATCACACTAACAGATGGACTGCAGGGG
TTACACTCCAGCTAATGCATTTGAGGAGAGCAGACTGTGAGGCCCGCAAAGACTCCCAATTCCAAGCCGCTCTCTACACA
AAAATGTAAGAGTGGTTGATAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTC
AAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCA
AGAGATCCGTTGCTGAAAGTTGTATAGATTTTATAGGCTGTTTTAAGGCCTTCTAAACGTTCTGATACATTCTTTTGGGG
TATATTGTAATAACGTAGACCCTCTGGACGTTGCTCACAGGAAAGCCGACAGCAGTGAAGCTGCGCAGCAAACCTCAACT
CCGAGCCCAAAAGCTCGATAACCAGAATACGGGTCTACAGAAGGTGCACAGGTGGAAAAGTAAAAATGACAGACGTGCAC
AGTACTCCCTGAGGAGCCAGCAACAGTCCACCAAGTTTATTCATTAATGATCCTCCGCA

Images

200609
cc7.jpg
Copyright © 2011 Knarkkorven
200603
cc1.jpg
Copyright © 2011 Knarkkorven
200604
cc2.jpg
Copyright © 2011 Knarkkorven
200605
cc3.jpg
Copyright © 2011 Knarkkorven
200606
cc4.jpg
Copyright © 2011 Knarkkorven
200607
cc5.jpg
Copyright © 2011 Knarkkorven
200608
cc6.jpg
Copyright © 2011 Knarkkorven
200610
cc8.jpg
Copyright © 2011 Knarkkorven
200611
cc9.jpg
Copyright © 2011 Knarkkorven
200612
cc10.jpg
Copyright © 2011 Knarkkorven
200613
cc11.jpg
Copyright © 2011 Knarkkorven
200614
cc12.jpg
Copyright © 2011 Knarkkorven
200615
cc14.jpg
Copyright © 2011 Knarkkorven
200616
cc15.jpg
Copyright © 2011 Knarkkorven
200617
cc16.jpg
Copyright © 2011 Knarkkorven
200618
cc13.jpg
Copyright © 2011 Knarkkorven
Habitat
200619
IMG_1206.JPG
Specimen ready for microscopy
200620
IMG_1205.JPG
Spores 1000x
200621
IMG_1207.JPG
Spores 1000x
200622
IMG_1209.JPG
Spores 1000x
200623
IMG_1212.JPG
Spores 1000x

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Very interesting!
By: Irene Andersson (irenea)
2012-02-21 07:20:48 CST (-0600)

- must be the first recorded obs of P. smithii from Sweden.

WOW
By: Darvin DeShazer (darv)
2012-02-21 00:13:44 CST (-0600)

Nice post!

Created: 2012-02-20 23:45:17 CST (-0600)
Last modified: 2012-02-20 23:45:24 CST (-0600)
Viewed: 243 times, last viewed: 2016-11-03 11:52:42 CDT (-0500)
Show Log