Observation 88085: Panaeolus alcis M.M. Moser
When: 2011-09-16
Collection location: Sweden [Click for map]

Notes: Macroscopic photos by knarkkorven. Micrographs by Alan Rockefeller.

10.00 micrometer divisions.

Thread here.

On moose dung.

Cheilocystidia abundant. Pleurocystidia absent.

Spores (15.5) 17.0 – 19.3 (19.5) x (8.9) 9.0 – 10.2 (10.9) μm.

15.55 × 8.88
17.00 × 9.23
17.08 × 9.32
17.36 × 8.75
17.91 × 8.61
18.26 × 9.86
18.40 × 9.02
18.61 × 8.81
18.95 × 9.09
19.09 × 10.13
19.23 × 10.90
19.25 × 10.27
19.36 × 9.02
19.37 × 9.58
19.37 × 9.93
19.51 × 9.09

ITS1 sequence:

TATGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATGGTTCAAGTTGTCCAAGTCAATGGACGGTT
AGAAGCGGGGCAAACACCTTTTTACAGCAATCCTAGACCACGGCGTAGATAATTATCACACCAATAGATAGGTTTGCGCG
GGGCACCCACTAATTCATTTGAGAGGAGCTGACCTTTCGGCCTGCAGAAACCTCCACATCCAAGCCATCATCACAAAAGC
GATGAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCTTCGGAATACCAAAGAGCGCAAGGTGCGTTCAAAGATTC
GATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCC
GTTGCTGAAAGTTGTATATAGTTTATAGGCTTAGAGCCCATTGAATCGTTCTGTTACTTTCAATAGTGTATATGTATAAG
CATAGGACCTGAACGTCAAGGAATTGCTTCCCTTCCCTCCAGACCTACAGTGTGTTCACAGGTGGAAAAACAAAAAAGGT
AAGGCGTGCACAGTTCCCCCGAGAGGGACAGCAACAACCCACCCAGTTTATTCGATAATGATCCTTCCGCAGGTCACCTA
CGGAAACCTTGTTACGACTTTTACTTCCTCTAA

BLAST matches:

Panaeolus sphinctrinus isolate AFTOL-ID 1499 18S ribosomal RNA gene from Worcester, PA – 99% query coverage, 99% match
Panaeolus campanulatus voucher 10141 18S ribosomal RNA gene from Italy – 96% query coverage, 99% match
Panaeolus rickenii voucher 12446 18S ribosomal RNA gene from Italy – 96% query coverage, 99% match

If you want to compare the DNA, it is very easy. Go to neucleotide blast, paste the sequence into the Query Sequence window, for the database select Neucleotide sequence (nr/nt) and press BLAST.

Species Lists

Images

200659
pa2.jpg
200631
pa4.jpg
Copyright © 2011 Knarkkorven
200632
pa5.jpg
Copyright © 2011 Knarkkorven
200633
pa6.jpg
Copyright © 2011 Knarkkorven
200634
pa7.jpg
Copyright © 2011 Knarkkorven
200635
pa8.jpg
Copyright © 2011 Knarkkorven
200636
pa9.jpg
Copyright © 2011 Knarkkorven
200637
pa10.jpg
Copyright © 2011 Knarkkorven
200638
pa11.jpg
Copyright © 2011 Knarkkorven
200639
pa12.jpg
Copyright © 2011 Knarkkorven
200640
pa13.jpg
Copyright © 2011 Knarkkorven
200641
pa14.jpg
Copyright © 2011 Knarkkorven
200642
pa15.jpg
Copyright © 2011 Knarkkorven
200643
pa16.jpg
Copyright © 2011 Knarkkorven
200644
pa17.jpg
Copyright © 2011 Knarkkorven
200645
pa18.jpg
Copyright © 2011 Knarkkorven
200646
pa19.jpg
Copyright © 2011 Knarkkorven
200647
IMG_1270.JPG
Specimen ready for microscopy
200648
IMG_1271.JPG
Cheilocystidia
200649
IMG_1273.JPG
Cheilocystidia
200650
IMG_1283.JPG
Cheilocystidia
200651
IMG_1286.JPG
Cheilocystidia
200652
IMG_1292.JPG
Cheilocystidia
200653
IMG_1276.JPG
Spores 1000x
200654
IMG_1278.JPG
Spores 1000x
200655
IMG_1280.JPG
Spores 1000x
200656
IMG_1282.JPG
Spores 1000x
200657
IMG_1288.JPG
Spores 1000x
200658
pa1.jpg
200660
pa3.jpg

Proposed Names

29% (1)
Recognized by sight: On moose dung.
Based on microscopic features: All microscopic features match.
87% (1)
Eye3 Eyes3
Recognized by sight: On moose dung
Based on microscopic features: All microscopic features match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Now in GenBank
By: Alan Rockefeller (Alan Rockefeller)
2014-12-19 00:41:48 PST (-0800)

KM982723 – http://www.ncbi.nlm.nih.gov/nuccore/726965694

While Gerhardt 1996 places this in Panaeolus section Laevispora, ITS sequencing shows that this species has a close affinity to Panaeolus papilionaceus, which is in Panaeolus section Panaeolus.

Yes,
By: lightworkerpeace (gsharpnolack)
2012-06-17 19:41:24 PDT (-0700)

I was looking at the old name.

Gerhardt 1996
By: Alan Rockefeller (Alan Rockefeller)
2012-06-17 11:14:20 PDT (-0700)

You have the Gerhardt monograph, right?

sources for descriptions
By: lightworkerpeace (gsharpnolack)
2012-06-13 19:24:27 PDT (-0700)

Do you have the links to the descriptions you used for reference?

Very cool mushroom!
By: Matt Sherman (Shermanii)
2012-02-21 07:01:10 PST (-0800)

Created: 2012-02-21 02:13:17 PST (-0800)
Last modified: 2012-02-21 02:25:23 PST (-0800)
Viewed: 589 times, last viewed: 2016-11-29 08:29:11 PST (-0800)
Show Log