Observation 90428: Panaeolina castaneifolia (Murrill) Bon
When: 2012-03-17
Who: Byrain
Herbarium specimen reported

Notes: Growing in grass at an apartment complex, the taste and smell are both unpleasant/farinaceous.

The spores are roughened & not flattened without oil drops and a germ pore.
Spore range = 14 – 15 (17) x 8 – 10 μ
Spore average = 14.35 × 8.95 μ
Average Q = 1.61
20 spores measured from a spore print.

Cheilocystidia measurements = 30×6, 30×7, 30×8, 31×7, 31×8, 34×7, 37×9, 40×7 μ
4-spored basidia range = 24 × 30 (32) x 8 – 11 (12) μ
Epicutis cell width range = ~ 22 – 45 (68) μ
Epicutic cell average = 34.13 μ
Clamps are present.

Images

206563
206562
206564
Spore prints were more distinctly brown before they dried which I failed to get any pictures of.
206565
Cheilocystida
206566
Spores
1000x
Mounted in KOH
206567
Spores
1000x
Mounted in melzers
1μ divisions
206568
Pileipellis
1000x
Mounted in KOH
1μ divisions
206569
Panaeolus olivaceus (89608) on the left.
Panaeolina castaneifolia (90428) on the right.

Proposed Names

85% (1)
Eye3 Eyes3
Recognized by sight
Used references: Gerhardt
Based on microscopic features: Distinctly roughened & non-flattened spores without oil drops, basidia consistently 4-spored, epicutis cells mostly over 25 μ wide.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Disagree
By: Byrain
2016-05-16 03:58:31 CDT (-0400)

Slides take up more storage space and are less economical. The other points could apply just as well to foil.

Microscope slides are the best
By: Rocky Houghtby
2016-05-16 01:15:37 CDT (-0400)

media for spore prints, because you can set them on top of any surface to compare colors. It is also much easier to transfer a controlled, uncontaminated amount of spore mass onto another slide for microscopy. Not to mention, slides fit perfectly into most tackle box slots; with a little fiddling, and a clean collection box, you can have a dozen spore prints done before you get home.

Foil is best.
By: Byrain
2016-05-16 01:01:13 CDT (-0400)

I always take spore prints on foil if possible and its always possible to see the spore color difference with Panaeolina, Panaeolus and a good print.

Alan, if you want to see…
By: Dave W (Dave W)
2016-05-15 21:38:38 CDT (-0400)

the brown/purple tinge for dark spores like these, then I suggest taking a print on a pure black surface. The subtle difference between dark brown and black is best seen on a black medium.

Now in GenBank
By: Alan Rockefeller (Alan Rockefeller)
2016-05-15 17:09:00 CDT (-0400)
Thanks Byrain.
By: Dave W (Dave W)
2016-03-31 07:49:42 CDT (-0400)

I’ll likely have an opportunity this spring to look at some Panaeolina foenisecii spores. The ones that grow annually on my lawn have been IDed to species as part of the Panaeolus study conducted through MO. So this gives me an opportunity to see if I can find the oil droplets. Looking at P.f. KOH mount spore photos I have, I don’t see the droplets. I’ll try an H2O mount.

I realize that oil-immersion/1000x would be superior to 400×. As a fairly casual hobbyist, my approach is to examine as much different material as possible in my spare time, so ease and convenience take preference. I preserve material that seems interesting and am willing to pass it along to someone who is capable/willing to analyze.

Re: Questions.
By: Byrain
2016-03-30 21:52:46 CDT (-0400)

The guttules (Oil droplets) in Panaeolina species do not appear to be affected by conventional mounts, you should be able to see them in just H2O or KOH. 400x may be enough to see them, but you really should invest on a 100x oil immersion objective for spore microscopy.

The literature indicates that Panaeolina foenisecii has most spores with guttules and P. castaneifolia has most spores without. There are other differences, but that is the easiest to observe. The problem is the latter taxon is under studied, the guttules may or may not be species specific and sequencing this collection does not seem to be enough to solve this mystery on its own.

What we do know is that this collection microscopically matches P. castanefolia as described in Gerhardt’s Panaeolus monograph and whether it is a valid taxon or not is not restricted to North America as the monograph indicates. However its not entirely surprising that species that occur in lawn turf could be transported overseas through human activities among many alternative scenarios. If this was the case it may have not been true when the monograph was written.

Additionally there are other P. foenisecii sequences from Sri Lanka with lower percentage matches, these seem to be a different species and may represent P. indica or maybe just entirely misidentified.

The pothole appearance with spores is due to them collapsing, in this case its probably a result of being mounted in melzers regent.

Couple of questions…
By: Dave W (Dave W)
2016-03-30 19:16:08 CDT (-0400)

If spores this dark contain oil droplets, is there any special preparation necessary to see them under a scope? Would 400x suffice?

In the second spore photo it looks like two of the spores feature a portion of the surface that has collapsed inward, forming a “pothole”. Is there any significance to this?

Thanks!
By: Byrain
2016-03-30 18:41:23 CDT (-0400)

Looks like there are several 99% matches, mostly unidentified Panaeolus collections from both NA and Europe. There is one under the name Panaeolina forenisecii, but it was made from soil samples and no actual specimens were studied.

This seems inconclusive, just that it occurs in at least two continents. More specimens that have been studied thoroughly need to be sequenced as well, especially those with spores that have guttules.

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-03-30 17:39:05 CDT (-0400)

GGATTGTGCACGCCCTACCTTTTTTGTTTTTCCACCTGTGCACACACTGTAGGTCTGGAGGGGAAGGGAGGCAACTCCCTGACGTTTCAGGTCCTATGTCTTTACACATACACTATTAAAAGTAACAGAACGATTCAATGGGCTCTAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCATCGCTTTTGTGATGATGGCTTGGAAGTGGAGGTTTTTTGCAGGCTGAAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGATCCTTAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCTTTGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGATTGTCCGAGTTGTAATCTAGAGAAGCATTATCCGCGCTGGACCGTG

Created: 2012-03-19 22:58:58 CST (-0500)
Last modified: 2012-03-20 02:50:58 CST (-0500)
Viewed: 301 times, last viewed: 2016-11-24 15:07:48 CST (-0500)
Show Log