Observation 92159: Psilocybe allenii Borov., Rockefeller & P.G. Werner
When: 2011-11-30
Herbarium specimen reported

Notes: Debbie Klein collection.

ITS1 sequence:

TATGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATTGTCATTATGTGCTGTCCGAATAAACGGAC
GGTTAGAAGCAGCTTCAACCCATTGAGAGCAGACGTCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGG
GCAGCCGGCTAATGCATTTAAGGGGAGCTGACATCTCAAGAGAAGCCGGCAAAATACCCCCAAGTCCAAGCCATTACACA
AGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGT
GCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGA
GAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCATAAAGCCATAAGAAACATTCTGTTACATTCTTTGG
GGTATATGAAAACGTAGAGCGCCGAAAAAACCTTCAACTTGAAGGACAAGTCCCTCTCCTATCCAGTTCCAACGTCTACA
AAAGGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCACGCCAAAGTTA
TTCAATAATGATCCTCCGCAGGTCACCTACG

Images

211103
pc7.JPG
Copyright © 2011 Debbie Klein
211097
pc1.JPG
Copyright © 2011 Debbie Klein
211098
pc2.JPG
Copyright © 2011 Debbie Klein
211099
pc3.JPG
Copyright © 2011 Debbie Klein
211100
pc4.JPG
Copyright © 2011 Debbie Klein
211101
pc6.JPG
Copyright © 2011 Debbie Klein
211102
pc5.JPG
Copyright © 2011 Debbie Klein

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
nice.
By: Richard and Danielle Kneal (bloodworm)
2012-04-07 23:01:24 SAST (+0200)

Created: 2012-04-07 15:27:02 SAST (+0200)
Last modified: 2012-12-10 12:07:05 SAST (+0200)
Viewed: 112 times, last viewed: 2016-12-04 21:06:30 SAST (+0200)
Show Log