Observation 92234: Psilocybe hopii Guzmán et J. Greene
When: 2011-08-02

Notes: Apple Drump collection.

ITS sequence:

TCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATTGTCATTATGTGCTGTCCGAATGAACGGACGGTTAGAAGCAGCTTTTAA
AACCCATTGATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTT
AAGGGGAGCTGACTTCAAATGAAGCCGGCAAAAGACCCCCAAATCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTG
AGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGA
ATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTA
TATAGTTTATAGGCACAAGGCCATATGATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGACCGCTTGAGAAAAAG
ACCTTCAACTCTGGGAGGGCCGTGAAGCTTCCCCCATCCTATCCAGTCTTCTTTCAAACGTCTACAAAAGGTTCACAGGTGGA
GATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGA

Spore measurements:

9.7 [10.7 ; 11.1] 12.1 × 5.6 [6.4 ; 6.8] 7.5 µm
Q = 1.4 [1.6 ; 1.7] 1.9 ; N = 30 ; C = 95%
Me = 10.9 × 6.6 µm ; Qe = 1.7

9.81 5.64
10.28 7.02
10.20 6.35
10.19 6.30
11.10 6.90
11.14 6.60
11.55 6.79
10.72 6.24
10.94 6.64
10.46 7.55
10.15 6.90
11.43 5.65
10.97 6.11
11.63 7.11
10.96 7.03
11.02 6.18
12.58 7.22
10.83 6.46
11.06 6.48
11.71 7.00
11.58 7.43
10.45 6.16
10.85 6.23
10.33 6.28
11.86 6.97
11.00 6.69
10.67 6.41
10.21 6.81
10.89 6.35
10.68 5.93

Species Lists

Images

211352
hopi6.jpg
Apple Drump
211347
hopi1.jpg
Apple Drump
211348
hopi2.jpg
Apple Drump
211349
hopi3.jpg
Apple Drump
211350
hopi4.jpg
Apple Drump
211351
hopi5.jpg
Apple Drump

Proposed Names

-29% (1)
Based on chemical features: 100% ITS region DNA match with the holotype of P. mescaleroensis

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Locality
By: Peter G Werner (pgwerner)
2013-03-14 03:06:43 CDT (-0400)

San Francisco Peaks, Coconino Co., Arizona, USA
http://mushroomobserver.org/location/show_location/7204

Hopi?
By: noshdoo tsoh
2012-04-15 18:50:27 CDT (-0400)

That is a really exciting find! So amazing that stuff like this is still being discovered!!

I’m not sure what the Hopis have to do with it though. I’d call any relationship tenuous at best. All local tribes, including the Navajo, consider all the peaks, mesas, and rivers in Northern Arizona sacred. The more prominent the mountain, the more sacred. The Hopis are very sedentary compared to the Navajo or Apache and that they would have known about this species seems a stretch, considering its tiny geographic distribution and the 150 mile distance from the Hopi Villages. It’s true that there have been some recent court cases involving Hopi claims to the Peaks, but these are gradually being thrown out. While I don’t have an alternative name suggestion, I just thought I’d express my impression that a Hopi connection seems to have no basis. Navajo more likely if the Native connection is to be assumed.

Wow!
By: mycologia-anarcha
2012-04-08 14:02:04 CDT (-0400)

I had no idea this species existed. How wonderful.

Created: 2012-04-08 05:32:20 CDT (-0400)
Last modified: 2016-09-01 23:52:52 CDT (-0400)
Viewed: 1174 times, last viewed: 2016-12-09 12:37:43 CST (-0500)
Show Log