Observation 96369: Agaricus elwhaensis nom. prov. A.H.Sm.
When: 2012-06-04
Who: BlueCanoe
Herbarium specimen reported

Notes: Growing near deodar cedar (Cedrus deodara) and pitch pine (Pinus rigida). Pileus somewhat tacky.

Update: Returned the next day and collected both fruiting bodies. Flesh light yellow/orange with a white pith in the center of the stipe. Fresh cut smelled slightly of anise. Larger specimen measured 11 cm tall, cap 8.5 cm wide, stipe 2.5-3.5 cm wide, stipe 9 cm tall. Smaller specimen 9 cm tall, cap 7 cm wide, stipe 2-3 cm wide, stipe 8 cm tall. Spore print underway; specimens will be dried. White balance on photos taken 6/5/12 calibrated using gray card.

Update 2: Spore print is brown (dark gray-brown?). Specimens are dried and available.

Update 3: Returned 25 days later (6/29/12) and found a new, third specimen in the same location.

Species Lists

Images

224705
224706
224707
224737
225024
collected day after original observation
225025
collected day after original observation
225026
collected day after original observation
225027
collected day after original observation
225392
232965
third specimen, 25 days after original observation
232966
third specimen, 25 days after original observation

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Sequence data
By: Christian (Christian Schwarz)
2012-08-30 23:45:49 IST (+0530)

Although this specimen gave me some trouble (PCR didn’t amplify the DNA very well, the resulting sequence was a little dirty), I was able to get enough signal back to compare against the BLASTn database. The ITS1F region brings back a very good match for a couple strains of Agaricus augustus generated by Geml et al.

I looked at the SVIMS descriptions, and really can’t tell how they were distinguishing A. augustus and A. elwhaensis.

ITS1F sequence below:
>Agaricus elwhaensis_BlueCanoe_MO96369_ITS1F
CACGCCTGTTTGGACTTCATTTTCATCCACCTGTGC
ACATATTGTAGTCTTTGGTTGGGTTAGGAGGAAGT
GGTCATCCTATCAGCATCTGCTGGATGTGAGGACTT
GCATTGTGAAAACTTTGCTGTCCTCTATGTGATCATG
GAATCACTTTCTCACCAGAGTCTATGTCATTCATTAT
ACTCTGTCGAATGTCATTGAATGTCTTTACATGGGCT
TGTATGCCTATGAAAATTGTAATACAACTTTCAGCAA
CGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGC
GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT
GAATCATCGAATCTTTGATTTTTTCTTGCGCTCCTTGGT
ATTCCGAGGAGCTTTCGTGTGGGGAGTGTCATTAAAT
TCTCAACTCTCTTATACTGTTTGGTAGAAGAGAGCTTG
GACTGTGGAGGCTTGCTGGCCACTTGTTGGAGGTCAGC
TCCTCTGAAATGCATTAGCGGAACCGTTTGCGATCTG
CCACAAGTGTGATAAATTATCTACACTGGCGAGGGGAT
TGCTCTCTGTAATGTTCAGCTTCTAATTGTCTCTACTTTG
TGAGACTACTTTTTGAATACTTGACCTCAAATCAGGTAGG
ACTACCCGCTGAACTTAAGCATATCAAT

here’s a link to a photo by the late Ben Woo:
By: Debbie Viess (amanitarita)
2012-06-06 01:58:56 IST (+0530)

http://www.svims.ca/...

BlueCanoe’s Agaricus does indeed resemble this mushroom.

according to the Matchmaker/Smith description, cutting the flesh will also cause the yellow changing to orange color changes.

Get a spore print if you can! Not included in the original description.

Micro
By: Drew Parker (mycotrope)
2012-06-05 23:21:16 IST (+0530)

spores 7-8.5 x (4.7)5-5.9 microns, elongate, obovate to elliptic in face and side view, apiculus colorless, blunt, guttulation (droplets) obscure; basidia 4-spored, 17.5-24 × 8-9.5 microns, clavate, colorless; cheilocystidia abundant, forming sterile gill edges, 8-38 × 6-15 microns, often ellipsoid to obovate, often with a spherical, septate tip, occasionally cells clavate, spheropedunculate, napiform, or fusoid ventricose to cylindric in shape, often in bud-like catenulations, yellow in KOH, (Isaacs)

I can find only the one photo in MatchMaker, but I can say that it doesn’t look too far off. The size of elwhaensis is quite large (12-35 cm cap diam.). Appears this could fall out at the low end.

couldn’t find micro data for this nom. prov…
By: Debbie Viess (amanitarita)
2012-06-05 22:56:18 IST (+0530)

macro description sez that gills become “gray-wine” colored at maturity…now that’s rather different for an Agaricus sp!

Gills and nom. prov.
By: Christian (Christian Schwarz)
2012-06-05 22:18:12 IST (+0530)

Yeah, I agree that the gills were the biggest pointer away from Floccularia.
Darv’s got a great lead! That nom prov description, though brief, has some pretty interesting matching characters mentioned (yellow staining beneath/between cuticle).

At this point, even if the fruitbodies are beat up, the gills should be much darker.
If they’re still in decent enough shape to dry them, please do so! I’d love to take a look.

specimens
By: BlueCanoe
2012-06-05 22:11:36 IST (+0530)

Thanks for the help, everyone!

I left them where I found them, and can easily go back. It’s been pretty rainy since yesterday and I pulled them out of the ground to photograph; we’ll see what shape they’re in. I didn’t try to smell them. Based on memory, cap diameters were in the 6-10 cm range.

free gills, starting to brown…
By: Debbie Viess (amanitarita)
2012-06-05 20:45:52 IST (+0530)

eliminates all but Agaricus. Unless that brown on the gills is actually staining and this is a Leucoagaricus? A spore print woulda helped. How big is this?

Did you notice an odor? IF augustus (and I’m not quite buying it, either) there should be a strong almondy odor.

But w/out saving it or refinding it, a specific ID will be tough.

An interesting one
By: Drew Parker (mycotrope)
2012-06-05 11:53:24 IST (+0530)

I can see a possibility for Agaricus but it doesn’t look very "Prince"ly to me.

The color is not the main problem for this being Floccularia. The gills are very close and free or very nearly so as far as I can tell, and the edges in closeup look rough like they have cheilocystidia which are absent in F. albolanaripes. Also I’ve never seen such chunky scales and so much marginal veil tissue on that species.

Genus
By: Christian (Christian Schwarz)
2012-06-05 10:55:14 IST (+0530)

I can see how these could be Agaricus (something like the Prince), and the gills of A. augustus and some of its relatives can stay pale for quite a while. That said, something (I can’t decide what, yet) is ‘off’ for these to be in that genus, at least in my head.

Floccularia are often much yellower, but can also be quite drab. See observation 86135 for specimens similar to these.

Created: 2012-06-05 05:41:01 IST (+0530)
Last modified: 2015-03-21 04:38:29 IST (+0530)
Viewed: 476 times, last viewed: 2016-11-23 01:16:44 IST (+0530)
Show Log