When: 2012-08-11
Collection location: Davis, California, USA [Click for map]
Who: Byrain
Notes:
Growing in grass near the Bolbitius in observation 106483, same as the species in observation 73806.
Spores with 1 µm wall & minute germ pore
Spore range = 12 – 15 × 9 – 11 µ
Average spore = 13.15 × 9.7 µ
Q range = 1.3 – 1.56
Average Q = 1.36
Cystidia not observed
2-spored basidia observed
20 spores measured
Species Lists
Images
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 5.76 | 1 | (Byrain) | |||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
0.85 | 28.40% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 11.59 | 2 | (Alan Rockefeller,Byrain) | |||||
| Promising | 2.0 | 4.34 | 1 | (Rocky Houghtby) | |||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
2.57 | 85.55% | |||||||
Comments
Add Comment
a pileipellis picture and another terrible near useless one in observation 73806. When scoping this again today the pileipellis did match the illustrations given with the description. Finding cystidia was a chore, these tend to crumble instead cut into workable sections and I only saw a few cheilocsytidia. I’m hoping to find this again and get better microscopy while fresh later this year.
That is a really interesting id. Probably not exactly that species, since it was only seen around Madrid, or very strange to hop to the central valley-ish. But probably related somehow… need more details now. We need to see the pileipellis, and caulocystidia, and it might be nice to see a gill edge with a series of cystidia.
in the central valley, and always wondered what they were. Hope you figure it out.
If obs 74013 is the same as 106483, then I have seen that Bolbitius in 2 of the 4 locations I have seen this. Unfortunately there is no DNA yet, I’ll have to give more specimens for that soon. :)
Edit: Except it just occurred to me that this has a bulbous base and that Bolbitius doesn’t…
Its an infection or mutation affecting your 106483 species.
have an expanding cap, I’ve never noticed these to do that the few times I have observed them. The closest I have seen are:
http://mushroomobserver.org/113754?q=qJfQ
Excluding the location and habitat, but I wouldn’t be surprised if they were in the same genus.
http://www.flickr.com/photos/30273407@N02/2948882512/
spores should not be hyaline though.
Reminds me of observation # 23. This observation is a notable exception to Rule # 34.
I think there should of been some dna done on the last collection, but haven’t heard anything, I’ll see if I find out more…
A 100% match with http://www.ncbi.nlm.nih.gov/nucleotide/437037542 from Italy.
TAACTTGATGGGTTGTAGCTGGCTCTAACTTGAGTATGTGCACACCTGTCATTTTTATCTTTCCACCATGTGCACTTTGCATAGGTCTGAAAATCACTAGTCCTTGTGGACTTTTGATGTCTTGGGAACTGCTGTTCTTCACAGTCAGCTTTTCCTGTCTTCAGGCTCTATGATTTTTATATACACCATGTATGTTAAAGAACGCTTTACAGGCCTTCAAAGCCTATAAACATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCTCTACAACTTTGTTGTTAGTAGGTTGGAAGTGGGGGCTTTTTGTGAGATGTTTTAGTACGTCCCACTCCCCTGAAATGAATTAGCTGGAATGCCTCGGCAAATCCAACTATCAGTGTGATAAATATCTACTGTGGTTGTTGCATGAGGGTATCTGCTTCTCAACTGTCTGCAAAGACAACTTGAATCATTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA