Observation 118441: Alternaria Nees

When: 2012-11-28

Collection location: University of California Mycology Lab, Berkeley, California, USA [Click for map]

Who: Ecto-Mike (fastph)

No specimen available

Notes:
Identifying Features:

1) Muriform conidia, not produced from flask shaped fertile cell.
2) Conidia produced by budding directly from parent hypha or previous conidium.

DNA Sequence was blasted, and the result was consistent with the genus Alternaria.

>>[GGAAAGCTAGAAGACTGAGCGCCTTCAGAGTTGAAACCAAGCCTAAAGGACGCGAGACCTTTGCTGATAGAGAGTGCGACTGGGGCTGCGCTCCGAAACCAGTAGGCCGGCTGCCAATTACTTTAAGGCGAGTCTCCAGCAAAGCTAGAGACAAGACGCCCAACACCAAGCAAAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAATTATTAATTTGTTACTGACGCTGATTGCAATTACAAAAGGTTTATGGTTGTCCTAGTGGTGGGCGAACCCACCAAGGAAACAAGAAGTACGCAAAAGACAAGGGTGAATAATTCAGCAAGGCTGTAACTCTTTTGTGGTTCCAGCCCGCCTTCATATTTGTGTAATGATCCCTCCGCAGGTTCACCTACGGAGACCTTGTTTCGTTTTTTTACTTCCTCTAAATGACCAAGAGA]<<

Species Lists

Images

Shows budding of conidia
Shows muriform conidia.

Proposed Names

79% (1)
Recognized by sight
Based on microscopic features
Based on chemical features: DNA sequence data from ITS4.

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
No one has commented yet.