When: 2014-03-25
Collection location: Lucas Valley Rd., Marin Co., California, USA [Click for map]
Who: Debbie Viess (amanitarita)
Notes:
Collected at 400’ elevation in grassy meadow near live oak and bay laurel. Found by Andrew Nimmo; fruit bodies illuminated in his car headlights as he drove off at dusk!
Yellow A. vernicoccora also collected in same area.
Species Lists
Images
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 11.80 | 2 | (Alan Rockefeller,amanitarita) | |||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
2.77 | 92.19% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 11.80 | 2 | (amanitarita,Alan Rockefeller) | |||||
| Overall Score sum(score * weight) / (total weight + 1) |
-2.77 | -92.19% | |||||||
Comments
Add Comment
The sequence in GenBank is actually from http://mycoportal.org/..., which is a mislabeled Coprinellus micaceus. He is working on fixing the GenBank record.
a mistaken Genbank sequence has nothing to do with this sighting. If you have a complaint about Genbank, please direct your comments to Genbank or the sequence poster.
Gosh, human error. Could it be that it isn’t always so easy to read those base pairs w/out that computer interface? Coprinopsis was part of the several collections sent to Rob. And of course, many sequences up are from misidentified original specimens. Imperfect humans, imperfect process.
The DNA from THIS specimen was a match to vernicoccora, as previously stated.
Looks like just another little “Rockefeller” sideshow.
wrong obsie/wrong planet!
Or more like uploading the wrong sequence for the name. There must be some kind of mix-up…
was, thanks to Rob Powers, DNA determined to be a match with the more typical yellow form. No suprprise, though. Collectors have been finding these white spring coccora for generations in California.
Bojantchev did not mention this well known color morph in his species description of vernicoccora.
When describing a well known rather than a brand new to science species, it is best to take the time to do sufficient literature research, as well as speak to other more experienced collectors about their experience and findings.
In this case, it did take a village to get it right.
Sorry for the confusion on GenBank – the accession KR338835.1 has the wrong DNA sequence (the same sequences as Coprinellus micaceus KR338834.1). I have asked GenBank to update the record with the correct DNA sequence, which is also posted below. I will make a new note on this MO page once GenBank has fixed the mistake.
TGGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA
TCATTATTGGAATGAAATCTCTAGCAAGAGGCTGTTGCTGTCTAGTAATG
TGCACGCCTTTTGTGGAAAAATAAACCCTTAGCAGCAACTTGTTTCGATC
AAGTGACCTCAGGGTTATGGGCCCTGCGCGCTTCCACTGCGCCATGCTGC
TGTGTGGGGACTTATTTCTTCTCCCTGTGCACCACTTGTAGACTTTGTCT
GTCTATGAATCACATAACCTTATGAATGCATCTTTGTGCCCTTTATTATA
TACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA
GCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAAT
CTTTGAACGCATCTTGCGCTCTTTGGTATTCCGAAGAGCATGCCTGTTTG
AGTGTCATTAATCTCTCAAAACTTCATTTTTGTGAAGTAATTGGATATTG
GGAGTCATTGCTGGCGGCTGGTTGAAGCTCAGCTCTCCTTAAATTCCTTG
AGGAACGAAATGTTGGTGTGTGATAATAATTGTCTATGCCAAACAAGTAG
TTCCCCCCCTTTGCTATCTTAATGATTGACCTCAAATCAAGCAAGATTAC
CCGCTGAACTTAAGCATAC