When: 2014-09-29

Collection location: Gainesville, Florida, USA [Click for map]

Who: Richard Kneal (bloodworm)

Specimen available

Species Lists

Images

Proposed Names

57% (1)
Recognized by sight
-44% (2)
Recognized by sight
71% (5)
Recognized by sight: The closest BLAST hits suggest that this is in Amanita section Validae. Check to see if the spores are amyloid.
-43% (3)
Recognized by sight
3% (2)
Recognized by sight

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Yes, in my notes, very similar sequences have been associated with the phrase…
By: R. E. Tulloss (ret)
2018-02-08 13:22:44 PST (-0800)

“Amanita cf. submaculata.”

As we all know, MO allows you create a name with which you feel satisfied.

Richard Kneal sent me the sequence that Alan recorded here sometime back.

I obtained a sequence from RET 584-8 (sent to me by Sherry Kay from Kansas) that is an exact match to the one posted here. (A)

RET 531-3 = MO 107668 (sent to me by Steven Russell from Indiana) yielded two haplotypes (single SNP) that differ from the species under discussion by 0.2 and 0.3% respectively. (B & C) These distances are closer than those for sponsus (0.5 to 0.6%) although all differences are small.

All three of the sequences (A-C) are very close matches to the one under consideration and, are better matches to it than are the sponsus haplotypes (listed as “sp-C20” in GenBank), and have brown caps. Hence, I’m more inclined to think that the Florida, Kansas, and Indiana material represent an eastern taxon, not sponsus. Of course, my data is far from complete on this question.

These taxa were all called “cf. submaculata” in my notes because they were labeled “submaculata” before there was an opportunity to do sequencing.

Very best,

Rod

I’m a bit uncomfortable with a “sponsus” group.
By: R. E. Tulloss (ret)
2018-02-08 11:33:10 PST (-0800)

I don’t think there is enough evidence from white specimens before we include brown ones.

Rod

I also get that it is close to sponsus based on the nrITS sequence..
By: R. E. Tulloss (ret)
2018-02-08 09:57:15 PST (-0800)

I have found two apparent haplotypes in sponsus. Your sequence differs from both of them in your 135th character. Your sequence also has a two character gap after the 425th character (when the three sequences are aligned). Corresponding to the two gap position, one of my sponsus sequences has a “T-” and the other has “TC.” I have no idea as to how this translates to species boundaries. But the dark brown cap and the geographic location could reduce the likelihood of the taxa being the same.

I have a Kansas specimen that is also very similar to sponsus and the present taxon. The taxa are clearly close.

Rod

It’s really close to Amanita sponsus
By: Alan Rockefeller (Alan Rockefeller)
2018-02-04 13:45:41 PST (-0800)

The top two BLAST matches are likely that species, and all of the other BLAST matches are much further away.

There are two completely different things that have been sent to me called…
By: R. E. Tulloss (ret)
2015-01-19 21:25:10 PST (-0800)

submaculata. They have strikingly different nrITS sequences. One is the thing that I can easily recognize in the field as submaculata with virgate cap, copious partial veil, usually an odor that (to me) is like apples. The “proposed barcode” of the latter is NOT the one that matched Richard’s sequence. That and the distinctly different appearance of submaculata support the hypothesis that this observation doesn’t concern submaculata.

R

Herbert
By: walt sturgeon (Mycowalt)
2015-01-19 20:49:28 PST (-0800)

Could be more variable, but I see it every year in a variety of locations.

From the Amanita website: annulua subapical to apical, superior.

Amanita submaculata
By: walt sturgeon (Mycowalt)
2015-01-19 20:34:38 PST (-0800)

has an apical annulus and seldom varies this many warts.

Alan…
By: Richard Kneal (bloodworm)
2014-11-07 02:04:32 PST (-0800)

DNA here was good.

ill check the spores.

i agree, dave.

Lack of marginal striations on the cap…
By: Dave W (Dave W)
2014-11-06 19:19:43 PST (-0800)

and lack of the “rolled sock” collar on the bulb point away from the pantheroid types.

Sure looks like the Amanita pantherina group
By: Alan Rockefeller (Alan Rockefeller)
2014-11-06 15:00:05 PST (-0800)

I wonder if the dried collections were accidentally switched or if PCR products were switched/contaminated with another sample in the lab.

In my local database, this sequence is an exact match… EDITED
By: R. E. Tulloss (ret)
2014-11-06 13:44:58 PST (-0800)
for one collection (only) that I attributed to A. submaculata (which doesn’t look ANYTHING like your photos) and an unknown species sent to me from Kansas…the latter having a yellow cap and mistaken by the collector for a species in the “lavendula group.”

EDIT: By “exact match” I mean 100% identical.

OK. This would be an interesting situation to dissect. Clearly there is a mystery. Your photograph doesn’t look like either of the options I can offer.

Very best,

Rod

To get a good estimate of a section (lots of times, anyway)…
By: R. E. Tulloss (ret)
2014-11-06 13:33:43 PST (-0800)

you can go to GenBank and BLAST your sequence against the data base. Enough amanitas have had sequences posted by now so that the closest matches (even if not your sequence) have an apparently good likelihood (dancing around there a little) of being in the same section as your sample. In your case, those sequences having species names and near the top of the match list were all in section Validae.

Very best,

Rod

Hey, Richard.
By: R. E. Tulloss (ret)
2014-11-06 13:25:22 PST (-0800)

This posting of sequences is a super idea. However, I’m apparently not always being notified by MO when you post a sequence. Could you send me a list of MO numbers where I can go play in your sand (DNAs spelled backwards) box?

Very best,

Rod

ITS…
By: Richard Kneal (bloodworm)
2014-11-06 07:51:42 PST (-0800)

CATTATTGAACGAAAAGGGTGGCAAGGCTGTCGCTGGCTTGAATGAGCATGTGCACGTCTTTGCTGCTTATTTCATTCTCTTTCCTCCTGTGCACTTTTTGTAGACACTTGGGAATGAGAGGTCACATTGACTGACCTCTTGGCTTTGAAATGTCTGGGTGTCTATGCATTTTTATATACGCAGTTTGCATATTTATAGAATGAAATTATGGGCTATTTTGTAAGCCTTTAAATGATAAAGTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATATCTCAAAAGCCCCTTATGCCTCTCTTGTGGTGTGGGATTTTTGGACATTGGAAGTTGCCGGTCACTGATGAAAGTGGTGGGCTCTTTTGAAAAGCATTAGTTGAGGAGCTTTGTACTCTATGGTGTGATAGACTATCTATGCCAGGAGGTGCTCTACGATCCTCTGCTGTCTAACTGTCTTTATTGGACAACATGATAAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA