When: 2014-09-30
Collection location: Gainesville, Florida, USA [Click for map]
Who: Richard Kneal (bloodworm)
Species Lists
Images
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 5.94 | 1 | (bloodworm) | |||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
1.71 | 57.06% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 5.83 | 1 | (Alan Rockefeller) | |||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
1.71 | 56.91% | |||||||
Comments
Add Comment
And GenBank (as you have probably noticed) yields the same. All the closest matches are in the muscarioid group. For example the North American dominant muscarioid, A. persicina, and A. regalis all match to a large section of your sequence have have a percent of characters different from your sequence in the range of 3% to 4%. That’s outside of the range of variation that is observable in the large set of data from Dr. Geml’s work (and some additional sequences that his lab has prepared from additional North American material since 2008).
This is an unknown. If you can confirm clamps on the basidia, then it is probably in the muscarioid grouping.
Very best,
Rod
GAAACCTCAGGCAAGGGGGGAGGTAGGTTGTAGCTGGCCCCTAGGGGCATGTGCACACTGTCTCTCTCTTGCTTGTTTCTTCATTCTCTCCACTTGTGCACTGCTTGTAGGCAGCCTGGCACTGTTCAGGTTGTCTATGCTTTTCTTTACATACATCAATAATTGTTGTACAGAATGTTTTTAAAAAAGTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCTGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTGTCAAAACATGCACTTGAGTGTGTTTTGGATTGTGGGAGTGTCTGCTGGCTTTATATGAGCCAGCTCTCCTGAAAGACATTAGCTTTGGGGGGGAAGGTGCCAAGTCACTTCTGCCTTTCCATTGGTGTGATAGATGATATCTACACCAGGAAAGCAGGTGAAGCACTGTAATCTCTCTGCTCTCTAATTGACATTTGTCTGACAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGG
and to me is reminiscent of A. calyptratoides, the “candlestick amanita.” I know that nothing else about this mushroom is similar or even similar of sect. Caesareae…just that the stem is really peculiar on this one. Strange mushroom.
there was Lactarius indigo found in the same 6 × 2 bed.
that is why i found it particularly, interesting…
thanks for the response.
ill send you some.
It looks to me like a species of either sect. Amanita or sect. Validae. The saprobic amanitas are lepidellas. There must be a host tree within something like 10 to 30 meters. I have a Pin Oak that is host to amanitas that show up in my wildflower garden and (at even greater distance) under a dogwood in my front yard. In the cemetery in my town Amanita spreta occurs in some numbers at considerable distance from the edge of the oak dominated forest.
Very best,
Rod
i try my best.
is there anyway this might be a non-ectomycorrhizal species and how can i tell (w/o doing DNA on mycorrhizae)?
it was growing in a raised flower-bed (built) with flowers in it, mulch and soil…??
You sure do find some interesting stuff, Richard.
Very best,
Rod
Britt and i might need to apologize to that dood we flamed on FB. lol. ;)