When: 2014-10-04

Collection location: Gainesville, Florida, USA [Click for map]

Who: Richard Kneal (bloodworm)

Specimen available

Images

Proposed Names

48% (3)
Recognized by sight

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
primers
By: Alan Rockefeller (Alan Rockefeller)
2014-11-07 11:16:31 CST (-0600)

Why did you choose its4 over its4b?

primers…
By: Richard Kneal (bloodworm)
2014-11-07 02:47:19 CST (-0600)

1F-4

The closest match is not deposited in GenBank yet…
By: R. E. Tulloss (ret)
2014-11-06 22:57:30 CST (-0600)
because it is from a single collection from Long Island.

I had “closest matches” in sect. Phalloideae when I first tried to BLAST sequences from Amanitasp-57” against GenBank.

Amanitasp-57” is the closest match in our (Roosevelt group) local data base and morphologically looks very similar to Richard’s pictures. It has inamyloid spores and, from the evidence that we’ve accumulated, can be assigned to sect. Amanita.

http://www.amanitaceae.org?Amanita+sp-57

Very best,

Rod

BLAST matches
By: Alan Rockefeller (Alan Rockefeller)
2014-11-06 17:26:50 CST (-0600)

Most of the closest BLAST matches are section Phalloideae, but this doesn’t look like section Phalloideae. One BLAST match is from section Amanita. It would be interesting to see if this has amyloid spores.

I think that you will have had a few weak signals or other problems your raw data
By: R. E. Tulloss (ret)
2014-11-06 11:29:17 CST (-0600)

from the chromatograph. You have an unexpected character difference in the 5.8S sequence which is usually more conserved and a missing character near the end of 5.8S in a sub-string that is sensitive to some changes due to playing a role in how the molecule folds.

What primer(s) was/were used in the process of deriving the nrITS sequence in this case?

Very best,

Rod

Both ends are foreshortened here. EDITED
By: R. E. Tulloss (ret)
2014-11-06 11:02:09 CST (-0600)

For those who are not following:

In the order in which Richard is displaying his sequences, the “5’ end” is the left end of the sequence. The other end is called the “3’ end.”

How do I know that there is something missing?

The nrITS (nuclear ribosomal internal transcribed spacer or “proposed fungal barcode gene”) is made up of three component parts. You can tell if you have the sequence if you can find ACAACTTTCAA in the sequence. This is the beginning of the middle part called “5.8S”. Just before the beginning of whole shootin’ match of nrITS you get this warning (“nrITS begins with the next character”): AAGGATCATTA. After the last character of the nrITS you get this message (“nrITS finished prior to this message”): TTGACCTCAAATCA. Some people might leave off the first character (the first “T”). Christina and I are discussing whether we ought to do so.

If you look at the three sequences that Richard posted this morning (up to now). You will see that the “nrITS finished prior to this message” string is present in the Limacella subillinita sequence that he posted (MO 181439). It is also present in the string posted for MO 180920

Very best,

Rod

Best match is not really great: “sp-57” from Long Island, NY
By: R. E. Tulloss (ret)
2014-11-06 10:48:41 CST (-0600)

E-value = 0, Score = 463, Bitscore = 856.119, Identities = 497/513 (96%),  Positives = 497/513 (96%), Gaps = 3/513 (0%)

I’m going to look into whether there are quality issues on my end. Do you have .ab1 files for this that you could email me?

Rod

ITS…
By: Richard Kneal (bloodworm)
2014-11-06 09:56:50 CST (-0600)

GGCTCCCTGGGGAGCAAGGGCACGTCTCAAGTCATCATCAATTTCACCTGTGCACTAATGGAGATGCTTGGGAATGAGAGACTTTGACCAGTCTTTTGGTAGTTGAAATCTGGGTGTCTATGTTTTTTTGATTAAACACTTGATGGGTCATGAATGATAAATATTTGGCTTTTTGACAAGCCTATGTAATTATAGTGCACAACTTTCAACAATGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGGGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCACCTTGGTATTCCAAGGAGCATGCCTGTTTGAGTGTCATTAAACACCTCAAGACAACATCATGTGTTGTCTTGGATATTTGGGGGTTTGCAGGCTTTGGAAAGAGCCAGCTCTCCTTGAATGCATTAGTAGAGAGGACAACTGAGAACTCCATTGGTGTGATAAATCCATCTATGCCAGGAGCAAGCTGTATTGGC

Thank you very much.
By: R. E. Tulloss (ret)
2014-10-04 23:05:30 CDT (-0500)

I’m hoping we can get these into the sequencing process in time. We’ll have to give the material some code number…“sp-Fsomething.”

R

at first i thought…
By: Richard Kneal (bloodworm)
2014-10-04 18:01:01 CDT (-0500)

that you meant, “photograph them, for posterity…”
and i was confused…
then, i realized i didnt report an herbarium specimen. lol.

yes, i definitely kept them.
my mistake.

consider them, on the way.

Apparently, I don’t have a collection of this species.
By: R. E. Tulloss (ret)
2014-10-04 17:56:39 CDT (-0500)

I’ve given no code number to it, and I just searched for MO numbers associated with an unknown species of section Amanita in my herbarium and checked all those MO numbers against the observations corresponding to those numbers. I came up dry.

Can someone show me evidence to the contrary? I.e., evidence that I have thanked someone for sending me a collection of this species?

At the moment, we have a very good opportunity to get DNA sequences from species of section Amanita. It would be great to have material associated with these photographs.

Very best,

Rod

This critter again.
By: R. E. Tulloss (ret)
2014-10-04 17:51:44 CDT (-0500)

These are particularly beautiful photos of this species. I see that you did not capture them for posterity. What a pity.

This taxon is fascinating to me…seemingly so near to Amanitasp-N50” from Connecticut and Amanitasp-57” from Long Island.

Very best,

Rod