When: 2014-10-03
Collection location: Deep River County Park, Hobart, Indiana, USA [Click for map]
Who: Marielle Biscocho (mbiscoch)
Notes:
-This specimen was associated with the soil, and it was growing in solitary. —When I smelled it, the scent reminded me of freshly picked corn.
-The diameter of the pileus was about 2.9 cm.
-The cap was mostly light tan with some brown in some areas.
-The cap was smooth and greasy.
-The pileal shape was broadly convex, and the margin was also smooth.
-The flesh was observed to be a yellow beige.
-There weren’t any notable changes when the specimen was damaged.
The light brown stipe was a little bit off-center, but the stipe was closer to the center rather than the lateral areas.
-The stipe was measured to be about 3.0 cm in length and 0.6 cm in width.
-When the stipe was halved, it was observed to be hollow.
-The base was inserted.
-The surface of the stipe felt somewhat greasy, and it looked fibrillose.
-The light tan/beige gills were adnexed and even. There were four lamellae tiers arranged in a regular pattern.
-Many basidia were present when the specimen was observed under 40x magnification.
Species Lists
Images
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 10.35 | 2 | (Pulk) | |||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 5.83 | 1 | (Alan Rockefeller) | |||||
| Overall Score sum(score * weight) / (total weight + 1) |
0.19 | 6.20% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 5.83 | 1 | (Alan Rockefeller) | |||||
| Promising | 2.0 | 4.17 | 1 | (mbiscoch) | |||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 5.07 | 1 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
1.29 | 43.10% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 5.07 | 1 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 5.83 | 1 | (Alan Rockefeller) | |||||
| Overall Score sum(score * weight) / (total weight + 1) |
-1.05 | -34.84% | |||||||
Comments
Add Comment
My sequence consisted of 358 bp’s.
My sequence was: CAGGGTTTTTCGTAGGTGACCTGCGGAAGGTCATTATTGAATAAACTTGGTTGGGTTGTTGCTGGCTTCTCGGAGCATGTGCACGCCTAGCGCCATTTTTACCACCTGTGCACTTCTTGTAGATTTGAAACACCTTTCGAGGCAACTCGGTTTGAGGACTGCTATGCGAAAGCTAGCTTTCCTTGCGTTTCAGGTCTATGTTTTTACATACCCCATAAGAATGTTTTAGAATGTCATTAATGGGCTTTAGTGCCTCTAAATGAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
When I researched the GenBank for my sequence, the top 10 descriptions were mostly of Clitocybe species.
BLAST max score:593
BLAST total score: 593
BLAST query coverage: 91%
BLAST max identity:99%
- All your detailed notes are awesome!
- Call unidentified mushrooms with gills Agaricales sensu lato (as Could Be, so the observation will get titled with more specific suggestions)
- I think those are 400x magnification, 40x objective lens * 10x eyepiece
- The plural of “basidium” is “basidia”
From the very beginning, I made sure the labels were correct from the extraction process to PCR to DNA sequencing. Unless there was contamination, there shouldn’t have been a case where something was inaccurately placed. The sequencing wasn’t perfect, but the identified peaks were easily picked up.