When: 2014-12-30
Collection location: Yarrahapinni State Forest, North of Grassy Head, New South Wales, Australia [Click for map]
Who: Ian Dodd (kk) (www.kundabungkid.com) Australia (kundabungkid)
Notes:
May be see Observation: Amanita sect. Vaginatae sensu Zhu L. Yang (163300)
Cap just showing and surface area cleared. Amanita in wet soft soil Semi rainforest in part shade.
Species Lists
Images
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 4.49 | 1 | ||||||
| Could Be | 1.0 | 6.03 | 1 | (kundabungkid) | |||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
1.30 | 43.44% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 4.49 | 1 | ||||||
| Promising | 2.0 | 6.03 | 1 | (kundabungkid) | |||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
2.22 | 73.88% | |||||||
Comments
Add Comment
Rod, Thanks for the link to Observation 102465: Amanita sect. Vaginatae sensu Zhu L. Yang. It really does add interest in the procedings. Can can only watch and wait in awe.
See:
http://mushroomobserver.org/102465?q=sFQ
Amanita “williamsiae” is a member of the “TCT…” group.
Thank yous are posted on the above observation.
Very best,
Rod
Thanks for you comment, Ian.
Very best,
Rod
Just catching up. “08” gaining data. WoW. kk
… of what is possibly A. williamsiae, collected from the NJ Pine Barrens a few years ago: http://mushroomobserver.org/102465?q=sFQ.
Rod, was this material ever sequenced?
beginning of nrLSU can be found at the end of the discussion data field here:
http://www.amanitaceae.org?Amanita%20penetratrix
Amanita “sp-AUS08” is the first, known, brightly-colored member of the group (athough we suspect that Amanita “williamsiae” will turn out to be another yellow species in the group).
http://www.amanitaceae.org?Amanita%20williamsiae)
Very best,
Rod
So sp-AUS08 becomes still one more member of section Vaginatae with the unusual first characters (5’ motif) of the nrLSU gene that we originally saw in A. penetratrix and are now finding in many parts of the world.
Here is the 5’ motif shown in the context from which we recovered it. It begins at the eleventh character in the following string:
TTATGATTCATCTGACCTCAAATCAGGTAGGATTACCCGC
The initial TTATGATTCA is the end of the “proposed fungal barcode” in the present species. The remainder of the above is the beginning of (the 5’ end of) nrLSU.
Very best,
Rod
I was able to recover about half of the “proposed fungal barcode” gene and discovered that strongly matches with the same piece of the “barcode” gene from 202072. The yellow-dominated taxa of this observation and 202072 seem to have a high likelihood of being the same species.
Whattaya know?
This species seems classifiable as Amanita “sp-AUS08.”
Very best,
Rod
variant motif.
Maybe there is more to be said here.
Very best,
Rod
Thank you for giving us an opportunity to try.
Very best,
Rod
This material has been received and accessioned to Rod’s herbarium. We have also scheduled it for DNA sequencing.
Thanks,
Naomi
http://www.amanitaceae.org?Amanita%20sp-AUS08
Rod