Notes:
Heyowana collection (more information here)

Microscopic Observations
Spores:
Elipsoid-ovate in face view, inequilateral in side view, thick walled, avg 10×6µm

Cheilocystidia:
Abundant, forming a sterile band, ventricose-rostrate, occasionally branched, 20-25 × 6-10µm, neck length 5-10µm

Pleurocystidia:
Very rare, similar to cheilocystidia

Basidia:
4-sterigmate, 21-27 × 9-10µm

Species Lists

Images

Spores
Cheilocystidia
?Pleurocystidia

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Spore size
By: Jan Borovicka (bore)
2019-01-06 22:52:06 +03 (+0300)

P. tasmaniana shoud have much bigger spores – or not?

LSU sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-04 12:17:30 EEST (+0300)

TCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTTGCTGGCTTCSTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACCTTTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAATACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAATCTAGAGAAGTGTTRTCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGGGATCAACCTTGCTTTTGCTGGGTGTACTTTCCGGTTGACGGGTCAGCATCAATTTTGACCGTTGGATAAAGGCTTTGGGAAAGTGGCTTCTTCGGAAGTGTTATAGCCCATGGTCGCATACAACGGTTGGGATTGAGGAACTCAGCACGCCGAAAGGCCGGGTACTTGTACCACGTTCGTGCTTAGGATGCTGGCAT

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-14 03:58:17 EEST (+0300)

TGACTTGGCTCGGTTGCAGCTGGTCCTCTAGAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCT
GTGCACCTTTTGTAGACCTGGATTAGTTAATTTTCCGAGGAAACTCGGTCGGGAGGATTGCTTTCACAAGCTCTCCTTGC
AATTAACCCAGGCCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTATATTGGCCTTGTGCCTATAAACTAT
ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCA
GAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATT
AAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTTGCTGGCTTCCTCAAGAGGTCTGCT
CCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACCTTTGCATG
AATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAATACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCC
GCTGAACTTAAGCATATCAT

Psilocybe alutacea?
By: Zen Peddler (zen peddler)
2015-07-04 07:11:59 EEST (+0300)

Cystidia could fall within Psilocybe alutacea (almost lageniform) as would strongly striated margin assuming that is a taxonomically significant characteristic.
Although subaeruginosa also has hyaline lageniform c.cystidia.