Observation 208894: Brunneoporus malicolus (Berk. & M.A. Curtis) Audet

Notes:
On a fence post, probably oak. Had a very pleasant mushroom odor which had hints of pine and also smelled sweet.

Species Lists

Images

535049
DSC_3156.JPG
535050
DSC_3159.JPG
535051
DSC_3162.JPG
535052
DSC_3176.JPG
617651
antrodia-tree.jpg

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Pore measurements?
By: Derek Ziomber (Space Time Matters)
2018-04-19 01:16:14 CDT (-0400)

Did you happen to measure pore size?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-14 19:07:15 CDT (-0400)

GTTGTAGCTGGCGTTCTCGGACGCATTTTGTGCACGCCCTGATCATTATCCATCTCACACCTGTGCACACTCTGTAGGTCGGTTACTGGGGCTACTGTCTTTATTGGTGGTGCTCTGTGGCCTTCCTATGTTTTTATACAAACTACTCAGTTTAAAGAATGTCAATTGCGTGTAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTATTTGTGAATAGGGCTTGGACTTGGAGGTTTTGAATGCTGGATACTACTTTGTATTCAGCTCCTCTTAAATGCATTAGCTCGAGCCTGTTGTGGATCAGCTTCAGTGTGATAATTGTCTACGCTGTTCTGTGAAGCATTATTATATATGGGCCTTCGGCTTCTAATTGTCCTGTACTGGACAACATCTATGACCTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAA

Created: 2015-07-05 01:14:47 CDT (-0400)
Last modified: 2018-04-24 01:50:27 CDT (-0400)
Viewed: 78 times, last viewed: 2018-06-24 17:24:05 CDT (-0400)
Show Log