Notes:
On a fence post, probably oak. Had a very pleasant mushroom odor which had hints of pine and also smelled sweet.

Species Lists

Images

DSC_3156.JPG
DSC_3159.JPG
DSC_3162.JPG
DSC_3176.JPG
antrodia-tree.jpg

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Pore measurements?
By: Derek Ziomber (Space Time Matters)
2018-04-19 10:46:14 IST (+0530)

Did you happen to measure pore size?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-15 04:37:15 IST (+0530)

GTTGTAGCTGGCGTTCTCGGACGCATTTTGTGCACGCCCTGATCATTATCCATCTCACACCTGTGCACACTCTGTAGGTCGGTTACTGGGGCTACTGTCTTTATTGGTGGTGCTCTGTGGCCTTCCTATGTTTTTATACAAACTACTCAGTTTAAAGAATGTCAATTGCGTGTAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTATTTGTGAATAGGGCTTGGACTTGGAGGTTTTGAATGCTGGATACTACTTTGTATTCAGCTCCTCTTAAATGCATTAGCTCGAGCCTGTTGTGGATCAGCTTCAGTGTGATAATTGTCTACGCTGTTCTGTGAAGCATTATTATATATGGGCCTTCGGCTTCTAATTGTCCTGTACTGGACAACATCTATGACCTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAA