Notes:
On an oak fence post.

Species Lists

Images

DSC_3193.JPG
DSC_3196.JPG
DSC_3200.JPG

Proposed Names

57% (1)
Recognized by sight
93% (2)
Based on chemical features: ITS sequence match

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-23 15:37:59 PDT (-0700)

GGGTTGTAGCTGGCGTTCTCGGACGCATTTTGTGCACGCCCTGATCATTATCCATCTCACACCTGTGCACACTCTGTAGGTCGGTTACTGGGGCTACTGTCTTTATTGGTGGTGCTCTGTGGCCTTCCTATGTTTTTATACAAACTACTCAGTTTAAAGAATGTCAATTGCGTGTAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTATTTGTGAATAGGGCTTGGACTTGGAGGTTTTGAATGCTGGATACTACTTTGTATTCAGCTCCTCTTAAATGCATTAGCTCGAGCCTGTTGTGGATCAGCTTCAGTGTGATAATTGTCTACGCTGTTCTGTGAAGCATTATTATATATGGGCCTTCGGCTTCTAATTGTCCTGTACTGGACAACATCTATGACCTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA