Observation 209054: Boletales E.-J. Gilbert

Notes:
Under Quercus and Fagus.

Species Lists

Images

DSC_3357_2.JPG
DSC_3360_2.JPG
Screenshot from 2018-05-16 02-29-38.png
Email from Roy Halling regarding this collection

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Alan,
By: I. G. Safonov (IGSafonov)
2018-05-15 10:36:33 MDT (-0600)

I am not getting any Retiboletus hits with your sequence in GenBank. The highest similarity is below 90% and the hit pattern doesn’t make any sense. I’ve trimmed away the LSU fragment (ITS2 ends with GAAAC), but that hasn’t changed anything. Any ideas?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 09:59:42 MDT (-0600)

TGTGCACGTCGACCTTTTAACTCTACACACCTGTGCACCTGTTGTAGGTCCTCGAAAGAGGATCTATGTTTTTCATAATCACACCTATCGTATGTCTATGGAATGAATGTAATCGAGATATAAATCATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTGAATTCTCAACCATGCCCCCCTTTTGAAGTGGGGGGCATTGGCTTGGAGTTGGGAGTTTGCTGGTAGTGAAGGCTTGTCAGCTCTCCTGAAATGCATTAGTGTGAGAGACGTGCACGGCCTCCGACGTGATAATGATCGTCATGGCTGGAGCGTTTTGAGACCATGCCCAATGATATTTTGAAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAG

Created: 2015-07-06 12:57:43 MDT (-0600)
Last modified: 2018-05-16 09:45:31 MDT (-0600)
Viewed: 95 times, last viewed: 2020-02-08 04:09:04 MST (-0700)
Show Log