Notes:
Under Quercus and Fagus.

Species Lists

Images

DSC_3400_2.JPG
DSC_3402_2.JPG
DSC_3404_2.JPG
clavulina-tree.jpg

Proposed Names

57% (1)
Recognized by sight
48% (2)
Recognized by sight
58% (1)
Based on chemical features: Just 5 bases away from https://www.ncbi.nlm.nih.gov/nucleotide/JX287357.1, a sequence from Costa Rica

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 15:21:11 CDT (-0400)

ATGGGGGTTTGATGCTGGCTGTCATCCTTTTGGCTGCATGTTGCTCGCCCTCAGCAATCCTTTTCCAAACACCTGTGCATCTTGTGAGTTCGAGGAAGGGGGAACTCTTTCTTGTCTCATGATTCATAAACGCCGCCTGTAAATATTGAATGCTGTTCGTGCCGTTAAGGCCTTAACCATAATACAACTTTTGACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGAGAGTACGCCTGTTCGAGTGTCGTGAAACTGTCAAGCTAGGATGCGCTTTTCCTGGCTTGGTTTGTTGGGCTTTTGCCGGTGTCCTTTCACTAGGGAACGGGCTGGCCTTAAAAGTATTAGCTGACTCCATGTGGTTATTGGTTTTCTACTCGGCGTGATAATTAGATGACCGCCGGGAAAGTGTCCCTCTGGGGATCGCCAATTTTCATCTGGGTTGCTTCTAATCTTGGAGCTTCGGTTCCATTTGTTCAACTTTGACCTCGAATCAGGTGGGACCACCCGCTGAACTTAAGCATATCAATA