Notes:
Under 5 needle pine.

Pileus viscid.

Odor strong and unique, and not entirely pleasant.

Spores 13.5 – 15.1 × 4.5 – 5.3.

13.0 × 4.7
13.5 × 4.6
13.5 × 5.0
13.6 × 4.8
13.6 × 4.8
13.7 × 4.6
13.7 × 4.7
13.7 × 4.7
13.9 × 5.1
14.0 × 4.6
14.0 × 4.8
14.0 × 5.3
14.1 × 4.5
14.3 × 4.5
14.3 × 4.6
14.3 × 4.8
14.3 × 4.9
14.3 × 5.0
14.5 × 4.5
14.5 × 4.8
14.5 × 5.0
14.5 × 5.3
14.5 × 5.4
14.6 × 5.1
14.7 × 4.7
14.7 × 4.8
14.9 × 5.0
15.1 × 4.3
15.1 × 5.0
15.2 × 4.7

Species Lists

Images

DSC_1156_modified.JPG
DSC_1161_modified.JPG
DSC_1173_modified.JPG
DSC_1133_modified.JPG
DSC_1131_modified.JPG
DSC_1132_modified.JPG
DSC_1130_modified.JPG
DSC_1122_modified.JPG
DSC_1120_modified.JPG
DSC_1110_modified.JPG
spore1000-2.jpg
Spores 1000x
bolete200x.jpg
Basidia 200x DIC. 50 micrometers? 20 micrometers? The truth is probably somewhere in between.
bolete1000x-3.jpg
Spores 1000x
bolete1000x.jpg
Spores 1000x
sp11.jpg
Spores 1000x
orig.jpg
Basidia 400x

Proposed Names

29% (1)
Recognized by sight
58% (1)
Based on chemical features: In the ITS sequence there is one solid base pair difference and two ambiguous differences from the European Boletus pinophilus.

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Boletus pinophilus species complex
By: I. G. Safonov (IGSafonov)
2018-02-05 09:00:01 PST (-0800)

Take a look at the excellent porcini paper by Feng et al. in PLOS One (May 2012, Volume 7, Issue 5, e37567). Therein the authors write:
“…within the porcini s.s. lineage, even if we merged three species from North America (B. subcaerulescens, B. regineus and B. subalpinus) to B. pinophilus (Fig. 2) due to their limited ITS sequence variations (Table 1)… The three American taxa, which were combined into B. pinophilus, show some morphological differences from each other, as well as from B. pinophilus. For example, B. subalpinus is different from other three by having a secotitoid feature. Our results suggested that ITS sequences may have evolved slower than morphological characters in this species complex. This phenomenon has been reported from some ectomycorrhizal fungi that have undergone recent adaptive radiations, such as species in Cortinarius.”

Difference of this species and European pinophilus
By: Gerhard Koller (Gerhard)
2015-12-22 12:51:06 PST (-0800)

First of all, the cap surface bears no resemblance at all … it is a mixture between aestivalis/reticulatus and in its wrinkles maybe even mottiae … the color is like aestivalis too whereas pinophilus has a reddish to almost violet hue in the cap and young appears like somewhat pruinose and whitish-reddish or liver-colored. Also the pore surface is too yellow in my book, the stem is too slender because pinophilus has a clubby one. What about the smell? The smell of pinophilus is different to all other king boletes it has a slight Scleroderma odor to it but not that penetrant and foul though. Upon cooking pinophilus turns green in the cap cuticle.

Interesting…
By: Davide Puddu (Davide Puddu)
2015-12-22 10:08:09 PST (-0800)

But i don’t see it so near to B.pinophilus, it seems like a midway to B.pinophilus and B.aestivalis , the cap has a different texture, the slender stem and i don’t see the red under the cuticle as i would expect to see in section in this species,although the color of the stipe looks almost identical.

Boletus subcaerulescens has been sequenced
By: Alan Rockefeller (Alan Rockefeller)
2015-12-22 05:28:52 PST (-0800)

My sequence is 6 base pairs different from B. subcaerulescens – three questionable differences and three definite differences. So while it is very close to B. subcaerulescens, it is closer to B. pinophilus.

Maybe time to…
By: Dave W (Dave W)
2015-12-22 04:57:40 PST (-0800)

re-re-think the non-staining “subcaerulescens” type(s). Has material IDed as subcaerulescens been sequenced?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2015-12-22 04:43:00 PST (-0800)

There is one questionable base pair difference and one solid difference from the European Boletus pinophilus.

AGGGAGGGAAAATGGACAAGGACTCTCAAGGCTGTCGCCGGCAACGTGCACGCCTTCCTCTTTCATGGACYCCCCCTTTCTAGTTTCCTTATCCACCTGTGCACCCTTTGTAGGCCCTCGAAAGAGGTTCTATGTTTATCTATCTACTACCACATGTATGTCCAGAATGTATACAAATTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCRTGTCTTGAATGAGGCATGGCTTGGACTTGGGGGTTGCTGGCACACGTCTGTCAGCTCTCCTGAAATGCATTAGCGATGGTCAGCAAGCCTGACGTGCACGGCCTTTTCGACGTGATAACGATCGTCGTGGGCTGGAGCGGTAGGGTGAGCGGTGAATCGCTTCTAATCTAAAGTCGGTCGTGAGACTGACTGAGGCTAGCCTT

Reminds me of…
By: Dave W (Dave W)
2015-11-10 19:24:38 PST (-0800)

B. subcaerulescens. I have seen examples that exhibit no blue staining at all. A pine associate.