When: 2015-11-08
Collection location: Capulálpam de Méndez, Oaxaca, Mexico [Click for map]
17.3127°N 96.4413°W 2149m [Click for map]
Who: Alan Rockefeller (Alan Rockefeller)
Notes:
Under 5 needle pine.
Pileus viscid.
Odor strong and unique, and not entirely pleasant.
Spores 13.5 – 15.1 × 4.5 – 5.3.
13.0 × 4.7
13.5 × 4.6
13.5 × 5.0
13.6 × 4.8
13.6 × 4.8
13.7 × 4.6
13.7 × 4.7
13.7 × 4.7
13.9 × 5.1
14.0 × 4.6
14.0 × 4.8
14.0 × 5.3
14.1 × 4.5
14.3 × 4.5
14.3 × 4.6
14.3 × 4.8
14.3 × 4.9
14.3 × 5.0
14.5 × 4.5
14.5 × 4.8
14.5 × 5.0
14.5 × 5.3
14.5 × 5.4
14.6 × 5.1
14.7 × 4.7
14.7 × 4.8
14.9 × 5.0
15.1 × 4.3
15.1 × 5.0
15.2 × 4.7
Species Lists
Images
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 6.83 | 1 | (Alan Rockefeller) | |||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
0.87 | 29.08% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 6.83 | 1 | (Alan Rockefeller) | |||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
1.74 | 58.16% | |||||||
Comments
Add Comment
First of all, the cap surface bears no resemblance at all … it is a mixture between aestivalis/reticulatus and in its wrinkles maybe even mottiae … the color is like aestivalis too whereas pinophilus has a reddish to almost violet hue in the cap and young appears like somewhat pruinose and whitish-reddish or liver-colored. Also the pore surface is too yellow in my book, the stem is too slender because pinophilus has a clubby one. What about the smell? The smell of pinophilus is different to all other king boletes it has a slight Scleroderma odor to it but not that penetrant and foul though. Upon cooking pinophilus turns green in the cap cuticle.
But i don’t see it so near to B.pinophilus, it seems like a midway to B.pinophilus and B.aestivalis , the cap has a different texture, the slender stem and i don’t see the red under the cuticle as i would expect to see in section in this species,although the color of the stipe looks almost identical.
My sequence is 6 base pairs different from B. subcaerulescens – three questionable differences and three definite differences. So while it is very close to B. subcaerulescens, it is closer to B. pinophilus.
re-re-think the non-staining “subcaerulescens” type(s). Has material IDed as subcaerulescens been sequenced?
There is one questionable base pair difference and one solid difference from the European Boletus pinophilus.
AGGGAGGGAAAATGGACAAGGACTCTCAAGGCTGTCGCCGGCAACGTGCACGCCTTCCTCTTTCATGGACYCCCCCTTTCTAGTTTCCTTATCCACCTGTGCACCCTTTGTAGGCCCTCGAAAGAGGTTCTATGTTTATCTATCTACTACCACATGTATGTCCAGAATGTATACAAATTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCRTGTCTTGAATGAGGCATGGCTTGGACTTGGGGGTTGCTGGCACACGTCTGTCAGCTCTCCTGAAATGCATTAGCGATGGTCAGCAAGCCTGACGTGCACGGCCTTTTCGACGTGATAACGATCGTCGTGGGCTGGAGCGGTAGGGTGAGCGGTGAATCGCTTCTAATCTAAAGTCGGTCGTGAGACTGACTGAGGCTAGCCTT
B. subcaerulescens. I have seen examples that exhibit no blue staining at all. A pine associate.
Take a look at the excellent porcini paper by Feng et al. in PLOS One (May 2012, Volume 7, Issue 5, e37567). Therein the authors write:
“…within the porcini s.s. lineage, even if we merged three species from North America (B. subcaerulescens, B. regineus and B. subalpinus) to B. pinophilus (Fig. 2) due to their limited ITS sequence variations (Table 1)… The three American taxa, which were combined into B. pinophilus, show some morphological differences from each other, as well as from B. pinophilus. For example, B. subalpinus is different from other three by having a secotitoid feature. Our results suggested that ITS sequences may have evolved slower than morphological characters in this species complex. This phenomenon has been reported from some ectomycorrhizal fungi that have undergone recent adaptive radiations, such as species in Cortinarius.”