When: 2016-03-20

Collection location: Elarduspark, Pretoria, Gauteng, South Africa [Click for map]

Who: Liz Popich (Lizzie)

No specimen available

Notes:
Medium size, bright orange, very scaly, cap diameter 40-60mm, brown lamellae, scaly stalk, grows on lawns.

Species Lists

Images

SAM_5979.JPG
side view of more mature
SAM_6011.JPG
young specimen
SAM_5988.JPG
underside
SAM_6131.JPG
underside

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
back to Liz’s question
By: Danny Newman (myxomop)
2017-09-21 13:22:52 EDT (-0400)

I am also interested in the morphological differences between these two spp.

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-15 16:24:19 EDT (-0400)

GATGGGTTGTAGCTGGCTCCTCGGAGCATGTGCACGCTTGTTCGGACTTCATTTTCATCCACCTG
TGCACCTTTTGTAGTCTTTGTCGGATTTTGAGGAAGTGGTCGGCCTATCAGCACTTGCTGGATTTGAGGA
CCTGTGGTGTGCAAGCACTGCTGTTCTCTATGCGACCATGGAATCGTCTTCCTGTCGGAGTCTATGTCAT
TCATATACCCTGTAGAATGTTATCGAATGTCTTTACATGGGCCTAGCCTATGAAAACTATAATACAACTT
TCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGC
AGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTT
TGAGTGTCATTAAATTCTCAACTCTCCAATACTTTTGCGGTAAAGGAGGGCTTGGATTGTGGGGGCGTGC
TGGCCACTTTGTGAGGCCAGCTCCTCTGAAATGCATTAGCGGAACCGTTTGCGATCTGCCACAAGTGTGA
TAACTATCTACACTAGCGAGGGGATTGCTCTGTGTTGTTCAGCTTCTAATCGTCTGCAAAGACAATTTTC
TGAATGCTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCAT

Depreciated name…
By: Glen van Niekerk (primordius)
2016-03-22 02:27:28 EDT (-0400)

I have seen that Agaricus trisulphuratus is now Cystoagaricus trisulphuratus.
Cystoagaricus is a genus of fungi in the family Psathyrellaceae.

http://mushroomobserver.org/name/show_name/30117

For Agaricus crocopeplus :
http://mushroomobserver.org/name/show_name_description/2078

Difference?
By: Liz Popich (Lizzie)
2016-03-21 07:34:58 EDT (-0400)

What is the difference between A.crocopeplus and A. trisulphuratus?