Notes:
Under white fir, jeffrey pine and incense cedar.

Staining black in KOH.

Species Lists

Images

coltricia2.JPG
coltricia1.JPG
coltricia3.JPG
coltricia4.JPG
coltricia5.JPG

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-13 13:15:05 PDT (-0700)

agAGTAGGGGTTTGCaATCTCTTGCCCTTCAATGCCCTCTGATGCTGGTAACAAGAACACACACTTGTT
ACATGTGCTCAAGGGATTTTTAGGGAAGGAGAGAGTGAATCTTCCTGCTTTCAAATCTGCTCATACTCTTTAACACCTGT
GCACCATAAGCAGAGTTCAATGTCTCTGAGTTAGCTTTTGTGATTAGTATATGTTATACATGTACCATTrTGGGTCCTAT
ATGGATCTGCATGGGGTGTATGCAATGTATATCTAyrCATGAAGGCAGCTTGGATGAATATATTGGCTCTGTTTTTAACA
CAAACTCTTAAAAATGTCATGTAGAATGAAATGCTCCAGTAGTGAGCAAAAACCTATACAACTTTCAACAATGGATCTCT
TGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTT
GAACACACCTTGTGCTCCTGGGGTCACCTATGGAGCATGCCTGTTTGAGTGTCATGTTGACTCAATTCCCCTCAGGTTTT
TCTTTATGAATGCCTGTTCAGGTGGAGTTGGATTTGGAGGTTTCATGCAGGTCCCCTTTGCGGGGGATCAGCTCCTCTTA
AAAACATTAGCTTTGAGGATCAAGCAAAAAGGCTCTTTAGCATTGTTCATTGGCTATGGTGTAATAATTGTTCCATCATG
GTGTTTTATATGATCAATGTGCTTGACTGGAGACTTTCTGAGCATCATCAGCTTCTAATTGTCAGGTCTATCCTGACACT
TATATTGACTCTTTGACCTCAAATCaGGTAGGACTACCCGCTGAACTTAAGCAT