Observation 236443: Psathyrella carbonicola A.H. Sm.

Notes:
Under white fir, jeffrey pine and incense cedar in an area burned by the rim fire.

Cap 1 – 3 cm, stipe 3 – 4.5 cm x 2 – 4 mm, with tiny squamules.

Species Lists

Images

610810
pcarbon2-8.JPG
610804
pcarbon2-1.JPG
610805
pcarbon2-2.JPG
610806
pcarbon2-3.JPG
610807
pcarbon2-5.JPG
610808
pcarbon2-6.JPG
610809
pcarbon2-7.JPG

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
LSU sequence with 5.8sr & lr0r primers
By: Alan Rockefeller (Alan Rockefeller)
2016-05-27 16:32:40 -05 (-0500)

TGCAGATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTG
TTTGAGTGTCATTAAATTCTCAACTTCACCAGTTTTGTTATGAGACTGTGTGATGCTTGGATGTGGGGGT
CTGTGCAGAATGCTTTACAGTCTTCTGCTCCCCTTAAATGAATTAGCGAGTTCAAACTAGGTTCCGTCTA
TTGGTGTGATAATTATCTACGCCGTGGATTGGACTTAGACTTGCTTCTAACCGTCTGCAAAGACAATCTT
TTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAG
AAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCT
TTGGCCATCCGAGTTGTAATCTAGAGAAGTGTTACCCGCGTCGGACCGTGTACAAGTCTCCTGGAATGGA
GCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGAGGCTTTGTGGTGCGCTCTCAAAGAGT
CGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACC
GATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAAT
TGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTAGCCAGAAATCAGCCTAGCTTTAGCTGGGTGTACTT
TCTGGTTGACGGGCCAGCATCAGTTTTGACCGGTGGAAAAAGTCTGGAGGAATGTGACATCTTCGGATGT
GTTATAGCCTCCAGTCGTATGCATCGATTGGGACTGAGGAACTCAGCACTTGTGCTTAGGATGCTGGCAT
AATGGCTTTAATCGACCCGTCTTGAAACACGGACCAGAGTCTAACATGCCTGC

Awesome.
By: Byrain
2016-04-11 12:50:27 -05 (-0500)

Can’t wait to see the results. It would also be cool to also eventually do the micro and compare it with what Smith described, there needs to be a lot of work done comparing what Smith recorded with new collections studied with more modern methods.

Yes
By: Alan Rockefeller (Alan Rockefeller)
2016-04-11 12:47:52 -05 (-0500)

I have two good collections of this on the dehydrator now from this weekend.

I will try to sequence them today. I plan to compare with http://mushroomobserver.org/227686, which gave a nice clean ITS sequence. I also need to do LSU to compare with the one in GenBank, http://www.ncbi.nlm.nih.gov/nuccore/120565339.

Do you have a collection?
By: Byrain
2016-04-11 11:07:17 -05 (-0500)

Created: 2016-04-11 03:33:04 -05 (-0500)
Last modified: 2018-02-13 05:40:27 -05 (-0500)
Viewed: 82 times, last viewed: 2018-05-21 14:19:44 -05 (-0500)
Show Log