Notes:
Collected under live oak. All photos taken with an iPhone 6.

Species Lists

Images

Entire stalk very lightly reticulated
Reticulations get larger toward the base
iPhone and a 10X hand lens
Stuffed tubes

Proposed Names

-62% (2)
Used references: Thiers, H. D. 1975. California Mushrooms: A Field Guide to the Boletes. Hafner Press, New York, NY. 261p.
Francisco J. Camacho & Tom Bruns. (no date in pdf) The molecular systematics of the Western U.S. edible ectomycorrhizal mushrooms in the Boletus edulis complex, Boletus section Edules.
Both, E. E. 1993. The Boletes of North America: A Compendium. Buffalo Museum of Science, Buffalo, NY. 436p.
17% (2)
Based on chemical features: DNA work by Alan Rockefeller.

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
wow, deja vu on that proposed ID chain
By: Debbie Viess (amanitarita)
2017-11-21 13:12:42 CST (-0600)

and in the end … it was edulis after all.

This is var. grandedulis
By: Alan Rockefeller (Alan Rockefeller)
2016-07-08 18:26:01 CDT (-0500)

It’s Boletus edulis var. grandedulis – a 100% match with http://www.ncbi.nlm.nih.gov/nucleotide/425785141 and two Arora collections. I am surprised that the BLAST results didn’t show that using the default settings – the reason is that the other people who sequenced Boletus edulis var. grandedulis used different primers than I did, so the query coverage wasn’t 100%, causing the exact matches to not even be within the first 100 results. When I changed the algorithm parameters to return 250 results and then sorted by the ident column, its true identity became clear. I used the its1-f and its4-b primers for PCR and sequenced with its1. I have found Boletus edulis var. grandedulis growing with coast live oak before, so this is just an out of season fruiting.

So was it not an exact match
By: Ron Pastorino (Ronpast)
2016-07-07 10:38:05 CDT (-0500)

for B. edulis var grandedulis? How close?

Repost of the DNA by Alan with returns to shorten the string to fit on MO.
By: Darvin DeShazer (darv)
2016-07-07 10:03:02 CDT (-0500)

Each line terminates in a keyboard return.
aGGGGAGGGaAGACGGATGGAGGAGTCAAGGCTGTCGCCGGCAACGTGCACGCCCCTTTCTCTTTCGTGGA
ACCTCCCCTTTCTAGTTTCCTTATCCACCTGTGCACCCTTTGTAGGCCCTCGAAAGAGGATCTACGTTTTCTCT
ATATACGCTTTTTGCTACGCATGTCCAGAATGTATACAAACTTTACAACTTTCAGCAACGGATCTCTTGGCTCT
CGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTT
TGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTCGAATTCTCAACCATGTC
TTGAATTAGGCATGGCTTGGACTTGGGGGTTGCTGGCACACGTTGTCAGCTCTCCTGAAATGCATTAGCGAT
GTTCAGCAAGCCTGAACGTGCACGGCCTTTTCGACGTGATAACGATCGTCGTGGGCTGGAGCGTAGGGTGA
GCAGTGAATCGCTTCTAATCTATACCTCAGTTACTAGTCGGTCGTGAGACTGACGAACGCGCGAGGCTTGATC
TTGGACCCCAAGCCTTAGTTACTAGTCGGTCGTGAGGCCGACGAACGCGCAGGGTTAGGACCATTTGAACTC
TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA