Species Lists

Images

Proposed Names

76% (1)
Recognized by sight: growing on dry sandy soil, under a conifer, possibly a cypress, by marsh or coastal area.

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
alan
By: Danny Newman (myxomop)
2016-07-04 20:07:24 CDT (-0400)

please shrink your image

ITS sequence and phylogenetic tree
By: Alan Rockefeller (Alan Rockefeller)
2016-06-29 02:05:36 CDT (-0400)

TGGTGGGTTGTTGCTGGCTCCTTGGGAGCATGTGCACACTCATCATCTTTATCCATCCACCTGTGCACCTTTTGTAGTCTTGGAGGTGTCATAACATGCGTGTATATCTGAGTCCACTTATGGACTTCAGGAGTGGGGTCTGCCATGGCTGGCTTACTCTGGGTGGGTTCACGCGTGTATACCCTCTGAGTCTATGTTTTTCATATACCATATTGCATGTCTTCAGAATGTATGATCACAGGCCTCTGTGCCTATAAAACATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCCCACCAGCTTTGTGCAGCTGGCTTGGTGGCTTGGATAATGGGGGTTTTTTGCGGGCCTCTCTCTCTTGAGGTCAGCTCCCCTGAAATGCATTAGCGGAACGGTTTGCAGTCCTGTCACTAGCGTGATAAACTATCTACGCTAACACATGATAGGTTGCTCTCTGATAGTTCAGCTTCTAACTGTCCCATTTCATGGACAACCATGTGTGCATTACACAACTTTGACACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA