Notes:
A lot of these lining the stream banks. No bruising or color changes after 1 hour.

Species Lists

Images

Proposed Names

74% (3)
Recognized by sight
Based on chemical features: GenBank accession #MH234468
61% (2)
Based on chemical features: LSU sequence and GenBank data

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank accession #MH234468
By: I. G. Safonov (IGSafonov)
2018-04-26 18:57:27 EDT (-0400)
Thanks, Don…
By: I. G. Safonov (IGSafonov)
2017-02-01 23:06:37 EST (-0500)

…for your kind words and for making the material available for sequencing. This one was certainly one of the more interesting cases I recently worked on, as it led to an intriguing conclusion.

Very interesting results
By: Ryan Patrick (donjonson420)
2017-02-01 14:10:47 EST (-0500)

Another fantastic write-up Igor. I agree with your conclusions thus far and this probably belongs to Lanmaoa, I plan to dive into the papers mentioned tonight to get a better grasp on things. Thanks for your time, effort and great info to help nail these down really appreciate it.

DNA sequencing results and discussion
By: I. G. Safonov (IGSafonov)
2017-02-01 00:34:14 EST (-0500)

> A partial, contiguous 1306 bps long nrLSU sequence was obtained for this material. The first ~138 characters of the 5’ end (including the LR0R, ITS4 and ITS6R primers that comprise a total of 59 bases) are missing, but it’s still a usable sequence.
> A GenBank BLAST search of the full-length sequence did not return meaningful hits. There are no sequences of B. carminiporus in GenBank.
> However, a BLAST search of a partial sequence fragment (the first 841 characters) led to some interesting results. The 6 top-scoring hits are:

1) Tengia sp. voucher MEN-2015 = Lanmaoa roseocrispans — accession #KP327615 (959 bps long): 837/841 = 99.5% similarity; no gaps
2) Boletus sp. voucher HKAS 74765 = Lanmaoa angustispora — accesssion #KF112322 (800 bps long): 792/796 = 99.5% similarity; 1 gap
3) Lanmaoa angustispora voucher HKAS 74752 (holotype!) — accesssion #KM605139 (877 bps long): 785/789 = 99.5% similarity; 1 gap
4) Lanmaoa angustispora voucher HKAS 74759 — accesssion #KM605140 (877 bps long): 784/789 = 99.4% similarity; 1 gap
5) Lanmaoa flavorubra isolate NY775777 — accession #JQ924339 (919 bps long): 810/824 = 98.3% similarity; no gaps
6) Lanmaoa pseudosensibilis voucher DS615-07 — accession #KF030257 (880 bps long): 790/806 = 98% similarity; 2 gaps

> Morphologically, Boletus carminiporus is very similar to Boletus bicolor var. borealis. They share the all-red color scheme of cap, pores and stipe, though the pore surface of carminiporus is yellow when young. Borealis was recently transferred to Lanmaoa by Bessette et al. (2016) following the sweeping phylegenetic revisions of the Boletaceae published by Nuhn et al. (2013) and Wu et al. (2014 & 2016); it is now called L. borealis. Interestingly, when the genus Lanmaoa was erected by Wu et al. (2015, “Four new genera of the fungal family Boletaceae”), borealis was not reassigned even though the data necessary for the transfer had already been in existence (Nuhn et al. 2013 & Wu et al. 2014). At the same time, the authors of the 2015 publication cared to transfer the North American B. carminipes and B. pseudosensibilis into Lanmaoa, citing the above publications germane to borealis as the justification.
> Surprisingly, alignment of the nrLSU sequences of MO244944 with that of Lanmaoa borealis voucher 2858 (accession #JQ326998; 867 bps long) revealed that the 806 bp overlay has 29 mismatched base pair, including 4 gaps. This corresponds to only 96.4% similarity, which is low for this conserved locus.
> Morphologically, B. carmininiporus is not really a dead ringer for the generic diagnosis of Lanmaoa on account of its pan-monochromatic color scheme and reticulated stipe. Indeed, in this regard it’s more similar to B. flammans and B. rubroflammeus, whose phylogenetic position in the Boletaceae has not yet been elucidated. However, unlike the latter two boletes, the flesh of B. carminiporus does not stain blue. On the other hand, the bluing hymenophore of this and other purported collections of B. carminiporus on MO is disproportionately thin compared with the thickness of the pileal context at all stages of development. This feature is one of the main distinguishing diagnostic traits of Lanmaoa. Additionally, the pore surface of Lanmaoa angustispora, a recently described species endogenous to SW China, also starts off yellow and changes to a shade of red at maturity.
> The nrLSU sequence of MO244944, identified as B. carminiporus based on gross morphology, is very similar to the corresponding sequences of up to three taxa assigned to Lanmaoa. The nrLSU locus is phylogenetically relevant. A tentative transfer of Boletus carminiporus to Lanmaoa is thus suggested pending further molecular data.

nrLSU sequence MO244944
By: I. G. Safonov (IGSafonov)
2017-02-01 00:33:57 EST (-0500)

> nrLSU sequence MO244944/Boletus carminiporus:
CGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGCAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGCCGGGGATCAACCTTGCTTCTCGCTGGGTGTACTTCCTGGTCGACGGGTCAGCGTCAGTTTCGGTCGCCGTACAAGGGCGAGGGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTTTCGTCGTATGCGGCGGTCGGGACTGAGGAACTCAGCATGGCCTTTCCAGGTCTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGCAAACTCGAGCGCGCAATGAAAGTGAAAGTTGAGACCTCTGTCATGGAGGGCATCGACGCCCGGACCTGAGTCTTTGACGACGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCTCTTGATTGGACCGCTCGGCGATTGGGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCGTCAGCGTTGAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGTGAAGAAGCCTTGGCAGCGATGCTGGGTGGAACCGCCTCTAGTGC