Notes:
A single specimen growing in a stand of deciduous woods (consisting mostly of oaks) surrounding the Yellow Rim Trail. The GPS coordinates I provided are fairly accurate, but not precise.
The cap colors are reddish-brown, except the extreme margin, which I think is somewhat unusual for B. bicolor. Also, the pileilellis appeas to be granulose and finely cracked. Other than that, it’s a dead ringer for B. bicolor. Some bluing of the pores and tubes, but the rich yellow context remains unchanged.

Species Lists

Images

Taken with a flash — the colors appear richer than they really are
Taken with a flash — the colors appear richer than they really are
Taken with a flash — the colors appear richer than they really are
No flash — natural/accurate colors; ISO = 250
No flash — natural/accurate colors; ISO = 320
Taken with a flash; no bluing of the context
A view of the waterfall area from the southern Rim Trail

Proposed Names

29% (1)
Recognized by sight
Based on chemical features: LSU sequence fragment is much closer to bicolor
-29% (1)
Used references: NAB & BENA by Bessette-Roody-Bessette

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Scott,
By: I. G. Safonov (IGSafonov)
2017-05-16 18:24:53 -05 (-0500)

On one hand, I am glad you asked about this observation; on the other one, I am not, and here is why.
This mushroom was sequenced, and I had great hopes for the results, as LSU is usually not a troublesome gene for boletes. Apparently, the LSUs of bicolor and rufomaculatus are sufficiently different (8 characters apart), allowing species separation. There are three reliable LSU sequences of bicolor in GenBank: KF030246, KF030247 (var. subreticulatus) and KF030250. There is only one rufomaculatus sequence in GB, KF030248, but, from what I understand, that one is associated with Ernst Both’s holotype collection. By the way, rufomaculatus naturally belongs in Baorangia, but it hasn’t been officially transferred yet.
Unfortunately, the LSU sequence of MO250611 suffered from an extreme case of the non-specificity/heterogeneity problem, as no primer-binding regions were observed. Only a short, readable fragment of 227 bps was procured:

AAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGCCGGGGATCAACCTTGCKTCTCGCTGGGTGTATTTCCTGGTCGACGGGTCAGCATCAGTTTCGGTCACCGTACAAGGGYGAGGGGAACGTGGCACTCTTCGGAGTGTGTTATAGCCTTTCGTCGTATGCGGTGGTGGGGACTGAGGAACTCAGCACGGCCCTAGGC

But even here there are two ambiguous characters, meaning that there are at least two haplotypes present.
Alright, let’s cut to the chase, the moment you’ve been waiting for. :-) This fragment is a better match to bicolor than rufomaculatus (1 vs. 5 additional bases off, respectively).

Any update on this observation?
By: Scott Pavelle (Scott Pavelle)
2017-05-16 15:27:41 -05 (-0500)

I’m curious to know if it’s one of the ones you submitted for DNA testing.

edge of margin often much lighter than the cap in bicolor group.
By: Martin Livezey (MLivezey)
2016-09-01 19:59:22 -05 (-0500)
I find I use that to help identify the species.