Observation 253680: Amanita sect. Amanita

Notes:
Collector: Joe Cohen
Habitat: mixed conifer/hardwood forest
Substrate: soil under gras
Nearest_Tree: conifers
Odor: unknown
Other: Location: Red Top Meadows trail, near NF Development Road 2656. (lat/lon from iPhone, elevation from Zigzag RD map (2002)).
Aspect: no slope
Substrate: soil in grass on trail, near S. edge of trail. Trail is ~ 3m wide.

Species Lists

Images

IMG_3677.jpg
IMG_3771.jpg
Dried collection, comprising 2 of the mushrooms shown in above photo. LH side — comprising 1/2 of larger mushroom and 1 complete smaller mushroom — will be sent to Herbarium Amanitarum Rooseveltensis. RH side, comprising other 1/2 of larger mushroom, will go to Molecular Solutions, LLC,...
MO_253680_ITS tree.jpg

Proposed Names

1% (2)
Used references: Gibson, Matchmaker: Mushrooms of the Pacific Northwest, Version 2.2 (Apr. 2014) (application, latest version downloadable at http://www.svims.ca/council/matchmaker.htm)
Trudell & Ammirati, Mushrooms of the Pacific Northwest (Timber Press 2009)
28% (1)
Recognized by sight
47% (2)
Recognized by sight
-56% (1)
Recognized by sight: Cap staining brown
4% (2)
Used references: See Comment below by Timoteo. Jan Lindgren suggests that this is possible.
-61% (2)
Based on chemical features: DNA match 100%

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Herbarium Rooseveltensis Amanitarum (R. E. Tulloss) has received specimen.
By: mcmacher
2017-04-27 12:37:57 PDT (-0700)

We have received the dried specimen. Thank you. It is being accessioned in Rod’s herbarium.

It’s up to you, Herbert.
By: R. E. Tulloss (ret)
2016-10-17 10:05:44 PDT (-0700)

Maybe if your leaving the name as a marker to prevent further error, you should say that to prevent other confusions in the future.

Very best,

Rod

Thanks for the response, Joseph.
By: R. E. Tulloss (ret)
2016-10-17 09:45:39 PDT (-0700)

My problem is that I cannot judged the original condition of the material. I see a sort of creamy yellowish color between warts. There’s no cross-section; so I can’t tell if there was a pigment remnant below the surface of the cap.

Rod

There were at least four species of muscarioid collected on Santa Cruz Island.
By: R. E. Tulloss (ret)
2016-10-17 09:43:37 PDT (-0700)

Three were new taxa. The name “sp-LG862” (one of the newbies) is similar to LG882. Maybe that is what you were thinking of. The fourth taxon would fit the description of A. muscaria subsp. flavivolvata.

Very best,

Rod

Cap color
By: Joseph D. Cohen (Joe Cohen)
2016-10-17 09:29:42 PDT (-0700)

The best I can do on cap color is image 665230 (which I white-balanced prior to posting.) I took the photo in situ when I made the collection. Are any of the mushrooms of a condition/age to tell the original cap color?

— Joe Cohen

The species belongs to the dominant North American muscarioid.
By: R. E. Tulloss (ret)
2016-10-17 09:10:40 PDT (-0700)

LG882 is the collector’s number. The color of the material cannot be projected from the DNA. If I remember correctly, all the LG numbers sequenced by Dr. Geml were red-capped or “peach”-capped (when we knew the color). Some were not the “dominant North American mucarioid”; however LG882 is.

When a sequence is incomplete (the LG822 sequence is missing 3 characters the start of ITS1) the match may be perfect, but scoring is likely to be reduced. Matt’s sequence has 50 leading characters on the left (5’) end that are missing in the GenBank sequence. Matt’s sequence also extends father beyond the end of ITS2 than does the matching sequence in GenBank.

This is a very, very good match as matches go. Do we know the original cap color?

That’s what will determine the name that is used.

Very best, Rod

Thank you, Joe.
By: R. E. Tulloss (ret)
2016-10-17 08:41:54 PDT (-0700)

Thanks for posting the sequences.

Very best,

Rod

Some BLAST results
By: Joseph D. Cohen (Joe Cohen)
2016-10-17 07:08:20 PDT (-0700)

Some BLAST results of sequence below:
Sorted by Max/Total Score, top ten matches include sequences which someone identified as
Amanita muscaria (4 sequences)
Amanita gemmata (3 sequences)
Amanita regalis (1 sequence)
unidentified (2)

Sorted by “Ident”, every identified sequence at 99% or higher is A. muscaria. See image 675557.

A tree shows this sequence surrounded by other A. muscaria.

Initial ITS sequence
By: Joseph D. Cohen (Joe Cohen)
2016-10-17 07:05:01 PDT (-0700)

By Matt Gordon, Molecular Solutions, LLC.
> MO_253680_ITS
AAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAAGAAACCTCAGGCAGGGGGAGGTGGTTGTAGCTGGCCCTTAGGGGCATGTGCACACCGTGTCTCTCTTGCTTGTTTCTTCATTCTCTCCACTTGTGCACTGCTTGTAGGCAGCCCTGGCATTGTTCAGGTTTGTCTATGATTTTCTTTACATACATGAACACTTGTTGTACAGAATGTGATAAAAAAATAGTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCTCAAAGCATACACTTGAGTGTGTGTTTTGGATTGTGGGAGTGTCTGCTGGCTTTATTATGAGCCAGCTCTCCTGAAAGACATTAGCTTTGGGGGGGAGGTGCCAAGTCACTTCTGCCTTTCCATTGGTGTGATAGATGAATTAACTTATCTACGCCAGGAAAGCAGGCTGCAGGTGATGCACTGTGATCTCTCTCTGCTCTCTAATTGACATTTGTCTGATAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTAAAATCTGGCAGTGTTTTGCTGTCCGAGTTGTAATCTAGAGAAGTGCTGCCCGTGCTGGA

Hello, Joe.
By: R. E. Tulloss (ret)
2016-09-29 09:45:51 PDT (-0700)

Jan wrote to me about a collection of yours. This might be what she wrote about. I do not recognize it. I would be very interested in reviewing material should that be available.

Very best,

Rod Tulloss

Could be pantherina group
By: Joseph D. Cohen (Joe Cohen)
2016-09-28 08:01:58 PDT (-0700)

Jan Lindgren suggest that the base and volva don’t look typical for A. muscaria, and it could be A. pantherina group.

Shaggy stipe and cap
By: walt sturgeon (Mycowalt)
2016-09-27 09:22:04 PDT (-0700)

is not typical of muscaria/pantherina groups.

Pantherina clade
By: AmatoxinApocalypse (AmatoxinApocalypse)
2016-09-27 07:37:04 PDT (-0700)

What about the (ameri)pantherina clade of Amanita which occur in this area? Their pilei can be this color, and they have concentric rings around the base of the stipe, also occur in the same habitat.

I am not well read on ameripanthera and its allies, but perhaps this collection falls in that group?

Tan-capped A. muscaria?
By: Joseph D. Cohen (Joe Cohen)
2016-09-27 06:30:52 PDT (-0700)

In the Pacific Northwest, there are several mushrooms that look like A. muscaria with a different cap color, including yellow, white, or tan. The yellow one has been studied at the molecular level, and those studies say that it is indeed A. muscaria. The other have not been studied. See Lindgren, ‘Trial key to the species of AMANITA in the Pacific Northwest’ at 11a (rev. 1998, 2014).

The white one has been found in the same general area as this Observation.