Notes:
This was fruiting on a 3-5 meter area of the lawn, not attached to any obvious wood, and was collected by Iman Sylvain.

The texture is very soft.

Species Lists

Images

Proposed Names

60% (2)
Used references: Fungi of Switzerland Vol 2, North American Polypores
Based on microscopic features: no clamps, no cystidia, no meltzers reaction, spores ellipsoid ~5 X 3.4
61% (2)
Used references: The genus seems like a good fit, but I have not yet looked for a description of this species
Based on chemical features: ITS match

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
got it.
By: Danny Newman (myxomop)
2016-10-27 20:32:43 EDT (-0400)

unrelated, we just collected some Tomentella out here, possibly T. neobourdotii (T. lilacinogrisea). Happy to send some material if interested.

Ns
By: Tom Bruns (pogon)
2016-10-27 17:33:13 EDT (-0400)

Hi Danny – an N means that the sequence at that point was ambiguous. Lots of Ns means the sequence was lousy, a few Ns at the ends of the sequence are normal – and was the case here.

The bigger question is what else has not been sequenced yet, and in the case of Ceriporia species the answer is most species. So, its possible this name is not quite right. C. lacerata was described from Japan. There are some North American species that are similar morphologically and have not been sequenced. ITS does not always differ between species. I just dug out the paper that described C. lacerata but have not found the time to compare it morphologically.

always a pleasure
By: Danny Newman (myxomop)
2016-10-27 15:08:55 EDT (-0400)

to see molecular confirmation of observations.

What are “the Ns”?

ITS sequence says its Ceriporia lacerata
By: Tom Bruns (pogon)
2016-10-24 19:21:43 EDT (-0400)

Other than the Ns its a perfect match to Cerioporia lacerata

CNTACTGATTTGAGCTCAGATTGNNANAAATTGTCTCGGTAAGAGACGACTATAAGCATGAACTAATAAATACTTCAACACCACAGCGCAGATAATTATCACACTGAAGGCGATCCGTAAGATTCACGCTAATGCATTTCAGAGGAGTCGACTAGAAGCCGACACAACCTCCAAGTCCAAGCCCACTAAACTTCATTACAAAATTTAGGGGTTGAGAATTCCATGAGACTCAAACAGGCATACTCCTCGGAATACCAAGGAGTGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAATTGTGTTATACACAGTAAACATTCTATAACTGAAGCGTTTGTAGTAAACATAAGAAAGGCTTGTTACCAACTATGAAATAGCTGGCTTACACCGTTTCTTACATAAAGTGCACAGAGGTTGAGAGTGGATGAGCCAGGTGTGCACATGCCTCGTTAAAGGCCAGCTACAACCCGTTCAAAACTCGATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAT