When: 2016-09-26
Collection location: South West lawn of Hilgard Hall, UC Berkeley Campus, Berkeley, Alameda Co., California, USA [Click for map]
37.873°N 122.2637°W 80m [Click for map]
Who: Tom Bruns (pogon)
Notes:
This was fruiting on a 3-5 meter area of the lawn, not attached to any obvious wood, and was collected by Iman Sylvain.
The texture is very soft.
Species Lists
Images
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 4.89 | 1 | (pogon) | |||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 5.15 | 1 | (Ronpast) | |||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
1.80 | 59.87% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 10.04 | 2 | (pogon,Ronpast) | |||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
1.82 | 60.63% | |||||||
Comments
Add CommentHi Danny – an N means that the sequence at that point was ambiguous. Lots of Ns means the sequence was lousy, a few Ns at the ends of the sequence are normal – and was the case here.
The bigger question is what else has not been sequenced yet, and in the case of Ceriporia species the answer is most species. So, its possible this name is not quite right. C. lacerata was described from Japan. There are some North American species that are similar morphologically and have not been sequenced. ITS does not always differ between species. I just dug out the paper that described C. lacerata but have not found the time to compare it morphologically.
to see molecular confirmation of observations.
What are “the Ns”?
Other than the Ns its a perfect match to Cerioporia lacerata
CNTACTGATTTGAGCTCAGATTGNNANAAATTGTCTCGGTAAGAGACGACTATAAGCATGAACTAATAAATACTTCAACACCACAGCGCAGATAATTATCACACTGAAGGCGATCCGTAAGATTCACGCTAATGCATTTCAGAGGAGTCGACTAGAAGCCGACACAACCTCCAAGTCCAAGCCCACTAAACTTCATTACAAAATTTAGGGGTTGAGAATTCCATGAGACTCAAACAGGCATACTCCTCGGAATACCAAGGAGTGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAATTGTGTTATACACAGTAAACATTCTATAACTGAAGCGTTTGTAGTAAACATAAGAAAGGCTTGTTACCAACTATGAAATAGCTGGCTTACACCGTTTCTTACATAAAGTGCACAGAGGTTGAGAGTGGATGAGCCAGGTGTGCACATGCCTCGTTAAAGGCCAGCTACAACCCGTTCAAAACTCGATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAT
unrelated, we just collected some Tomentella out here, possibly T. neobourdotii (T. lilacinogrisea). Happy to send some material if interested.