Species Lists

Images

Proposed Names

28% (1)
Recognized by sight: Growing Terrestrially from buried wood, extremely bitter taste, Pungent sweet perfume like odor. Same location as OB 238485. "The central species name is Gymnopilus junonius, which is the correct name for “Gymnopilus spectabilis,” according to the most recent taxonomists."

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
With a mis-match of 7 base pairs or 98.8% match
By: Terri Clements/Donna Fulton (pinonbistro)
2017-05-20 23:10:14 EDT (-0400)

I don’t think this is conspecific with any of the GenBank entries for B. junonius.

ITS 99%(603/610) to Genbank : FJ168571.1 (G. junonius)
By: Ryan Patrick (donjonson420)
2017-05-20 21:58:08 EDT (-0400)

ITS 99%(557/564) to Genbank : AY386831.1 (G. junonius)
ITS 99%(594/601) to Genbank : DQ486707.1 (G. spectabilis)

ITS Sequence – MO257058
By: Ryan Patrick (donjonson420)
2017-04-05 19:05:23 EDT (-0400)

CTGGAATTTTGAGGTCAAATGGTCAATAATTGTCCTTAAAGGACGATTAGAAGCAGCGCATCCCATTTAAAGCAGACATCTAACGGCGTAGATAATTATCACACCAATAGACAGTCCACGTAGGGCACCGGCTAATACATTTAAGGGGAGCAGATTTCTTGCAAAACCAGCAAAGACCCCCACATCCAGACCATTAGAAGCAAAAGCTAATAAGGCTGAGAATTAAATGACACTCAAACAGGCATGCCCCTCAGAATACCAAGGGGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAAAGTTTATAGGCACAAGGCCCAATGATACATTCTGTTACATTTTTGGAGTATATGAAAACATAGACTTGAACGTATTACAAGAAAAGCCACGAATGACATTCCTCCCAACCGAGTTGCCTCGGAAAGTTACAATTCAAATCTACAAAAAGTGCACAGGTGGAAAGATAAAGGTAACGGGCGAGCACATACTCTCTTGCGAGAGTCAGCTACAACCACGTCAAGTTTATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAATTGACCAAGAAATATTT