Observation 270902: Clitocybe nuda group

Species Lists

Images

DSC_3854.JPG
DSC_3821.JPG

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank KY859799
By: Alan Rockefeller (Alan Rockefeller)
2017-05-10 01:52:16 -05 (-0500)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2017-04-02 14:40:57 -05 (-0500)

GGGTTGTGCTGGCTTTTTGGAGCATGTGCACGCCTAGCGCCATTTTTACCACCTGTGCACACTTTGTAGA
TTTGAAACAACTCTCGAGGAAACTCGGTTTGAGGAATGCTGGGCAGAAGCTTAGCTTTTCTTGTGTTTCA
AGTCTATGTTTTTATATACCCCATAAGAATGTAATAGAATGTCATTAATGGGCTTTATTGCCTTTAAATT
AATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAA
TGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAG
CATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTTCAGCTTTTACAAGTTGGATTGGCTTGGATGTGG
AGGTTATTGCAGGCTTCTCAGAAGTCAGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGACCAGCTTT
GGTGTGATAATTATCTACGCCATGGTTGTGAAGCAGCTTTTATATGGGGTTCAGCTTCTAATAGTCCATT
GACTTGGACAATTTCTGACATTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAT
AAGCGGAGGAA