Notes:
Odor mild. Mild orange staining.

Species Lists

Images

DSC_3847.JPG
DSC_3846.JPG
DSC_3849.JPG
DSC_3850.JPG
_WCB4350.jpg
habitat
_WCB4351.jpg
habitat
_WCB4388 Pont Lobos State Reserve.jpg
habitat
_WCB4441 Hiking Pont Lobos State Reserve.jpg
habitat
_WCB4446 Alan photographiing agaicus mushrooms.jpg
_WCB4451 Alan photographiing agaicus mushrooms.jpg

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank MF150032
By: Alan Rockefeller (Alan Rockefeller)
2017-06-07 00:38:52 -05 (-0500)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2017-05-22 22:03:50 -05 (-0500)

100% match with EF460354 from Alaska. 1 base pair away from cultivated A. bisporus.

TTGTAGCTGGCTCTTCGGAGTATGTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTTTCAGGTATTGGAGGAAGTGGTCAGCCTATCAGCTCTTTGCTGGATGTAAGGACTTGCAGTGTGAAAACAGTGCTGTCCTTTACCTTGGCCATGGAATCTTTTTCCTGTTAGAGTCTATGTTATTCATTATACTCTTAGAATGTCATTGAATGTCTTTACATGGGCTATGCCTATGAAAATTATTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTATATTCTCAACTCTCCAATACTTTGTTGTAAAGGAGAGCTTGGATTGTGGAGGTTTGCTGGCTCCTTACTTGGGGTCAGCTCCTCTGAAATGCATTAGCGGAACCGTCTGCGATCTGCCACAAGTGTGATAACTTATCTACACTGGCGAGGGGATTGCTTTCTGATGTTCAGCTTCTAATCGTCTAAGGACAATTTCTTGAATGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA

Natives
By: Rick Kerrigan (rwkerrigan)
2017-03-10 11:49:41 -05 (-0500)

Point Lobos is one of the ancestral ‘safe harbors’ for the native coastal Californian population of this species, in association with the endemic Monterey cypress. A fairly high proportion of European individuals (‘strains’) are collected in other habitats and locales in the region.

Almost 40 species of Agaricus have been documented from cypress groves in CA.