Notes:
Cultured from http://mushroomobserver.org/274559

ITS sequence:

CTCGGTTGGAGGCACCTGCAGCTACCCTGTAGTTGCGGACTGCCAACTCCAGCCGCGGCCCGCCGGCGGTACACTAAACTCTGTTTTATTTTATATTCTGAGCGTCTTATTTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATCAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTGCTGTACTGCAGTTCCTTAAAGACAGTGGCGGAGCGGCGGTAGTCCTCTGAGCGTAGTAATTTATTTCTCGCTTTTGTCAGGCTCTGTCCTCCCGCCATAAAACCCCCAATTTTTTAGTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Species Lists

Images

DSC_6994-2.jpg
DSC_6995-2.jpg

Proposed Names

58% (1)
Based on chemical features: 100% ITS match with KF144883

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank MF073329
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 04:43:45 PDT (-0700)