Observation 281952: Amanita sect. Validae (Fr.) Singer

Images

757182
757183
757184
757185
757186
888271
Copyright © 2018 Alan Rockefeller
888272
Copyright © 2018 Alan Rockefeller
888480
Copyright © 2018 Alan Rockefeller
“in Melzer’s, 1000×. Calibration slide has 10 micrometer divisions”
888481
Copyright © 2018 Alan Rockefeller
“in Melzer’s, 1000×. Calibration slide has 10 micrometer divisions”
888482
Copyright © 2018 Alan Rockefeller
“in Melzer’s, 1000×. Calibration slide has 10 micrometer divisions”
888483
Copyright © 2018 Alan Rockefeller
“in Melzer’s, 1000×. Calibration slide has 10 micrometer divisions”
888484
888485
Amanita multisquamosa in the middle
888486
888487
888488
888489
888490

Proposed Names

-10% (3)
Based on chemical features: Matches MG937802, RET 548-1
-8% (5)
Recognized by sight
Based on microscopic features: Spore dimensions.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Since Amanita radiata is mentioned in the discussion below,…
By: R. E. Tulloss (ret)
2018-08-06 14:12:13 PDT (-0700)

we should also mention its range of Q and average Q.

Based on material revised by RET: Q (spores of one specimen) = (1.71-) 1.76 – 2.13 (-2.18), with an avg. Q of 1.90.

Based an unknown number of spores, Jenkins’ data shows Q = 1.71 – 2.20, with an avg. Q of 1.93.

This shape information is very much like that of media.

The spores of this material is more like that of _canescens__.

Since Amanita radiata is mentioned in the discussion below,…
By: R. E. Tulloss (ret)
2018-08-06 14:11:17 PDT (-0700)

we should also mention its range of Q and average Q.

Based on material revised by RET: Q (spores of one specimen) = (1.71-) 1.76 – 2.13 (-2.18), with an avg. Q of 1.90.

Based an unknown number of spores, Jenkins’ data shows Q = 1.71 – 2.20, with an avg. Q of 1.93.

This shape information is very much like that of media.

The spores of this material is more like that of canescens.

It should be stated that, while spores depicted in the attached photographs… EDITED
By: R. E. Tulloss (ret)
2018-08-06 13:44:25 PDT (-0700)

…are small enough to be hard to measure on screen, they are certainly not elongate to cylindric like the spores of media and radiata. I blew the spores up with photoshop 225×. In the first photograph, there were 6 spores approximately in lateral view

The overall average Q reported for media is 2.12. The range of Q for the species is reported as 1.99 – 2.29 (with an unknown number of spores measured).

The recorded Q range for Amanita canescens is (1.35-) 1.46 – 1.94 (-2.16) based on 125 spores measured.

The spores measured from the present material had a range of Q of 1.49 – 1.75, with an average Q of 1.57. This is much more like the spore morphology of canescens than that of media.

This species is not media or it is parasitized by something or it was drying in situ or there is/was some other problem.

Utilizing the reverse read obtained by Alan, I think the sequence can be extended…
By: R. E. Tulloss (ret)
2018-07-07 10:51:07 PDT (-0700)

to the end of ITS2. It is not an exact match to the previous A. radiata sequence previously obtained. For now, it seems appropriate to say that it may represent an ITS from A. media. The sequence had quality problems in the area surrounding the transition from ITS to LSU. The first three characters of LSU were not reliably readable in my opinion, but their location is reliably marked by a poorly detected “ACCTC” from “TTGACCTCTCAAATCA”.

The extended consensus sequence still does not include any fragment of 18S or the first 14 characters of (ITS). It contains the remainder of ITS1, the whole of 5.8S, the whole of ITS2, and the damaged fragment of the beginning of LSU. Using ITS4B as the primer for the reverse read would probably allow extension further into LSU and might make the LSU 5’ motif (above) readable.

Here is the sequence that I extracted conservatively from the forward and reverse reads from the ITS region of the voucher for the present observation:

GGCGAGACTGTCGCTGGCTTGAATGAGCATGTGCACGTCTTGTTGCTCCTTATTTCATTCTCTTTTCCACCTGTGCATTTTTTGTAGACATTCGGGATGGAGAGGTTGGTTCTGACCTCTTGAAAAAGTCTGGGTGCCTATGCATTTTCTATATACACAGTTGCATGTCTATAGAATGAGATTATAGGCTTGTCAGCCTTTAAATGATAAAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAAATATCTCAAAAAGCCCTTATGCTTTGGCATAGGAATTTTGGACATTGGAAGTTGCTGGCCACTAATGAAAGGTGGTAGGCTCTTCTGAAAAGCATTAGTTGAGGAGCCTTTTGCACTCTATTGGTGTGATAGACTATCTATGCCAGGAGATGCTTTTATGAACCTTYTGCTGTCTAACTGTCTTTATTTGGACAACATGATAAACNNNACCTC

Sequence differs from the previously derived radiata sequence in the following character positions (where the first character is “1”):

Within the ITS1 sublocus the differences could be discounted:
Gap following character 109 (variation in length of multi-T repeat).
The character 134 (was a het, “R” in previous sequence) is resolved to a “G”.

Within the 5.8S sublocus there are no differences.

Within the ITS2 sublocus there are a number of distances that be laid to signal quality deterioration. However, we need consider the alternative:
In characters 368-369, a single “C” has become a 3 “C-” repeat.
At character 403, there is an “A/G” difference.
At character 539 there is a “T/C” difference.
A character 541 there is a het (“Y”) intead of a “C.”

The three “N’s” at the beginning of LSU comprise characters 580 – 582 of the sequence.

Sincerely,

Rod Tulloss

I concur with Igor’s remarks on media/radiata biogeography.
By: R. E. Tulloss (ret)
2018-07-05 07:03:11 PDT (-0700)

Amanita section Roanokenses Singer is a real name. How to apply it is an open issue very much tied to the issue of how to make sense of the chaotic situation in what might be called Amanita pseudo-phylogeny that was discussed previously. I am opposed to creating more confusion by changing the name we use for the chaotic group. I believe that in the “don’t split” paper we mentioned that if a means of splitting up “section Lepidella sensu Bas” were to be found, “section Roanokenses” would apply to a small group that might include the present subsect. Limbatulae and little else. Let’s not mess with names at this point. Let’s just recognize we don’t have a resolution for the situation at the moment. There are problems that we can address with some hope of resolution.

The spore photos…
By: Dave W (Dave W)
2018-07-04 20:45:14 PDT (-0700)

were posted by Alan. Presumably, these spores came from dehydrated material. None of the mushrooms pictured appear to be particularly young.

Re spores
By: I. G. Safonov (IGSafonov)
2018-07-04 20:06:12 PDT (-0700)

One other thing I noticed about this observation is that there are 3 collected specimens, which are presumably the same species. In the picture immediately following the last microscopic image, the middle specimen with a broad cap and prominent and well-preserved PV is not only in excellent shape but is also of the right age to give representative spores… with Q values anticipated for media. If that specimen is available, it’s the one that should be used for spore measurements.
Another question that needs to be settled is the biogeography of media (and radiata). This collection was made in ME, suggesting that if the ID is correct, one should expect this taxon to fruit along the entire front of the Atlantic coastal plain. I will certainly start looking for it in NJ, which is a known northern “outpost” for a number of SE amanitas. It cannot hide from me forever! :-)

Given the explanation about spore Q…
By: Dave W (Dave W)
2018-07-04 19:21:03 PDT (-0700)

and the molecular data placing this entity into Validae (and the non-appendiculate cap margin), there appears to be no solid reason to continue to consider canescens as a possibility.

In addition to the really good stuff in Rod’s “teaching moment” (which includes perhaps the most compelling argument against the splitting of genus Amanita) two other points are made here. 1. Spores teased out of old/dry Amanita mushrooms may provide misleading measurements. 2. There appears to be no DNA data available for A. canescens.

Igor, I agree that having measurement data would be better than trying to measure…
By: R. E. Tulloss (ret)
2018-07-04 19:12:00 PDT (-0700)

a small number of spores with a paper ruler on a computer screen.

Very best,

Rod

I was willing to allow that an older specimen would have slightly smaller spores…
By: R. E. Tulloss (ret)
2018-07-04 18:51:45 PDT (-0700)

…having slightly lower Q value. This is a very common thing in amanitas that have gotten a little dry and a little past prime.

Very best,

Rod

Thank you, Rod
By: I. G. Safonov (IGSafonov)
2018-07-04 17:49:55 PDT (-0700)

I understand that the morphological and genetic evidence you discuss point toward sect. Validae and specifically A. media, which is currently a member of that section as per your website. However, in their majority the spores are ellipsoid-elongate, not cylindric, as per my measurements with a ruler pressed against the computer screen. According to the info in your website, the spores of the media protolog are solidly cylindric with the mean Q value of 2.12. It would be of benefit if either Alan or Herbert measured a requisite number of spores to give us a better idea of their dimensions for the record.

Hello, Igor.
By: R. E. Tulloss (ret)
2018-07-04 16:44:27 PDT (-0700)

I hadn’t even thought about the spores. I guess I didn’t see the images. I got triggered into a teaching moment…as you noticed.

I see a few spores that might have Q around 2.0 (I measured some on screen with a paper ruler.) That could certainly come from an over mature specimen of A. media. However, roanokensis spores have an average Q of about 3.30 to 3.50. (Bas, Jenkins, and I all came out with an average in that range.)

The mushroom looks like media, has spores that could be those of media, doesn’t have an appendiculate margin, doesn’t have a membranous volva on the bulb, and has a sequence that BLASTs to section Validae convincingly, with a pretty good match to a sequence of A. radiata from a specimen I determined. I still think I was pretty much in the ball park on that one.

This mushroom is not a Lepidella, and a good guess for an ID is Amanita media.

Very best,

Rod

Reverse read
By: Alan Rockefeller (Alan Rockefeller)
2018-07-04 16:29:36 PDT (-0700)

has been ordered.

Rod,
By: I. G. Safonov (IGSafonov)
2018-07-04 16:06:47 PDT (-0700)

Thank you for the teaching moment in your point of view summary…
How would you reconcile the pictorial spore data for this observation with the current identification consensus?

If you BLAST MH212116,…
By: R. E. Tulloss (ret)
2018-07-04 15:51:14 PDT (-0700)

you will get nothing but species of sect. Validae in your best matches.

I think the authors of MH212116 have misidentified something (possibly media) as Amanita roanokensis.

R

A summary of a point of view.
By: R. E. Tulloss (ret)
2018-07-04 15:20:18 PDT (-0700)

I have not yet seen a multi-gene tree for section Lepidella sensu Bas that I thought could legitimately hold water as a serious evolutionary hypothesis.

I have been dealing with this problem in one sense for 41 years. In another sense, I have been grappling with it since the first phylogeny with which I was involved (Weiss et al. in the mid-1990s) and, (more specifically) since the publication of Neville and Poumarat’s big book early in the current millenium and (very, very specifically) since 2012 (Wolfe et al and Vizzini et al.).

If one were to buy into the suggestion of the “don’t split Amanita” paper. Then there may very well be so much extinction involved in the currently available data on Amanita that we may not be able to make sense of the trees we have. Our process (method and data) of seeing into the past is inadequate. The group of amycorrhizal amanitas is not a clade; it is not a sister of anything. It is very probably the remnants of a “mother group” that would be at the base of the Amanita clade if it weren’t for a great loss of data that must have occurred over time.

As contemporary trees get bigger, and add more data, the results deteriorate just as predicted by the cladists who predicted and analyzed long branch attraction before there were large enough data sets to make long branch attraction manifest. You can’t get a better tree by adding more data to flawed data. That is not a guess, its mathematically demonstrable.

The sheer antiquity of the Amanitaceae and Amanita and the unexpected lack of conservation in nrLSU (perhaps because of the age, but very likely because of a higher rate of extinction than speciation in the oldest grouping within
the genus Amanita) make all the big trees to date most suspect in section Lepidella sensu Bas.

Deleting long branches is recommended when building trees; but this would mean removing a large number lepidellas and some other more recent taxa such as some Asian destroying angels. What we have is a large PhD thesis for which I see no volunteers because they would have to find some goal other than “mere” phylogeny to justify the effort.

My understanding of the present situation motivates me to I insist on using “section Lepidella sensu Bas” because that delimits a morphological grouping with very little ambiguity. And communication is a critical element to moving forward.

There are some relevant comments in the paper about not splitting Amanita.

Sincerely,

Rod

I agree with your suggestion about ordering a reverse read, Alan.
By: R. E. Tulloss (ret)
2018-07-04 14:35:40 PDT (-0700)

A reverse read, if obtainable would be very worthwhile. As you pointed out, you do have some issues with the forward read…as it stands. There are some parts that are extremely difficult to “decipher.”

Rod

Thanks for the chromatogram, Alan.
By: R. E. Tulloss (ret)
2018-07-04 14:31:39 PDT (-0700)

R

I agree
By: Alan Rockefeller (Alan Rockefeller)
2018-07-04 13:51:16 PDT (-0700)

I agree that my sequence matches MH212116. It came back really dirty and it took me 20 minutes to fix it – you can see the spots that I worked on it by looking at all the lower case letters. When a sequence comes back clean I leave it all upper case, but when it comes back dirty I try to salvage it by comparing the chromatogram with the closest BLAST matches and fixing the spots in the chromatogram where it is broken. What I do is I take the close BLAST matches as suggestions, and if the suggested peak is in the chromatogram in that place I change it, and if no peak is there I assume it’s a real difference. It’s not perfect but it does work 95% of the time. This one had quite a few errors and I am sure I didn’t get all of them – in a couple cases it looked like my sequence had errors but there wasn’t any trace of the signal I expected, so I couldn’t correct them without guessing and left those spots alone. I think my sequence is between 98 and 99% accurate.

I wonder if the same thing that made my sequence dirty also happened to Matt Smith when he processed the chromatogram for MH212116. Looking at the alignment, I don’t think the differences are real – they look like the same species but with dirty sequences on both sides.

I wonder if whatever it is that makes Lepidellas hard to sequence is the cause of the issues here. Perhaps more DNA purification before the PCR is in order.

I wonder how well MH212116 is identified.

I sent the chromatogram to Rod so he can take a closer look.

I could order a reverse read if anyone wants it, Genewiz saves the samples for one week so I still have a couple days left to request it. I haven’t requested it yet because I think the sequence we have is good enough, but it’s easy to do.

Redhead et al.
By: Erlon (Herbert Baker)
2018-07-04 13:50:45 PDT (-0700)

“Amanita sect. Lepidella sensu Bas consists of 2 sections. Adding to my comment about the lack of a formal section for the bulk of the ectomycorrhizal species in the former section Lepidella sensu Bas, and where I suggested that a subsection Solitariae could be raised to section rank, I have found that a sectional name is available, and that is Amanita sect. Roanokenses Singer (Sydowia 15(1-6): 67. 1962 1961), type species Amanita roanokensis Coker. However, a molecular investigation of the type has not been published.” – S. Redhead, 2016 https://mushroomobserver.org/...

Amanita stirps Roanokensis seems to be the more appropriate designation for now anyway.

Thanks!

Re name proposal
By: I. G. Safonov (IGSafonov)
2018-07-04 10:17:10 PDT (-0700)

‘Amanita sect. Roanokenses’ doesn’t makes sense. There is a ‘stirps Roanokensis, but it’s tucked into subsect. Limbatulae. The UV structure seen at the base of stipe in 281952 doesn’t appear to be consistent with that of taxa assigned to that subsection.

Mushroom seen in 3rd and 4th photos…
By: Dave W (Dave W)
2018-07-04 09:53:17 PDT (-0700)

shows very short marginal striations. I think this may be the result of the pileipellis drying/shrinking and as such causing depressions to form between the areas where the gills attach underneath. This is not unusual. I have seen it with destroying angels, blushers, and flavoconia, types that are considered non-striate. So, I would not rule out canescens on this basis.

Re BLASTn
By: I. G. Safonov (IGSafonov)
2018-07-04 09:15:34 PDT (-0700)

Examination of the sequence overlays for the top 3 hits shows that a few mismatching characters shared by the four collections/sequences are due to either ambiguities or gaps, and two of these consistently happen at the same location. The ITS of ‘A. roanokensis #MH212116’ has a very noisy 3’ end with a lot of ambiguities, but if one ignores that, then it could be conspecific with #MH016843 – for both collections were found in the Gainesville area (different sites though). Morphological ID of the vouchers and the DNA evidence aside (the apparent conspecificity can perhaps be explained by lack of a barcode gap in closely-related/recently divergent taxa – e.g., seen in Morchella and Agaricus), one also needs to address the disparity in geography and spore Q values between MO281952 and radiata/media/roanokensis. Also, there are no sequences of A. canescens in GenBank.

BLAST
By: Erlon (Herbert Baker)
2018-07-04 08:22:06 PDT (-0700)

Results seem to put it in a group with Amanita roanokensis, Amanita radiata, and Amanita “MH016843”, but at a slightly more basal position than the other taxa.

A. canescens
By: Erlon (Herbert Baker)
2018-07-04 07:53:05 PDT (-0700)
Just wondering…
By: Dave W (Dave W)
2018-07-04 07:46:10 PDT (-0700)

How close is this molecular data to what is expected with A. canescens?

Not sure if canescens qualifies as a “Lepidella/Validae fence-sitter”. But the sectionally ambiguous gross morphology of canescens suggests this. Recorded spore Q values for media, radiata, and canescens are as follows: media 2.12, radiata 1.90-1.93, canescens 1.66-1.67. Looking at the spore photo seen here, Q’ appears to be closest to that of canescens. I don’t see any spores with Q>2. So, I’m wondering why canescens is not part of this discussion? It seems not unlikely that, in the past, canescens may have been misidentified as one of these other taxa.

(Typing my comment while Igor was posting his…)

Spores
By: I. G. Safonov (IGSafonov)
2018-07-04 07:38:31 PDT (-0700)

The ellipsoid shapes of the spores in the recently uploaded images are not consistent with the elongate-cylindric spore shapes reported for radiata/media.

Info
By: Erlon (Herbert Baker)
2018-07-04 05:26:12 PDT (-0700)

If you enlarge the photo you can see the striations on the margin.

This collection (with the spore dimensions and Q values unknown for the moment)…
By: R. E. Tulloss (ret)
2018-07-03 10:42:19 PDT (-0700)

fits media in having a white cap at maturity and a non-striate pileus margin.

If those character states really separate radiata and media, then so be it. However, if they fail to separate Jenkins’ two proposed taxa. Then the name with priority is Amanita media.

Very best,

Rod

Finding Amanita media in Maine would be quite unexpected.
By: R. E. Tulloss (ret)
2018-07-03 10:06:29 PDT (-0700)

R

Amanita radiata is named for the virgate brown lines that mark the cap.
By: R. E. Tulloss (ret)
2018-07-03 09:41:46 PDT (-0700)

There is another species called A. media by Jenkins. The two morphological descriptions are very similar microscopically. I have considered that DNA might show them to be possible synonyms. You may have found supporting evidence for this synonymy.

Can you send me the raw data files (.ab1 files) for the sequence in question?

I would be interested to understand the ca. 1% variation in more detail.

Sincerely,

Rod Tulloss

I agree
By: Alan Rockefeller (Alan Rockefeller)
2018-07-03 07:48:51 PDT (-0700)

After looking at the dried specimen. I sent you the photos of what I sequenced via Facebook messenger.

Thanks Alan
By: Erlon (Herbert Baker)
2018-07-03 07:24:13 PDT (-0700)

I am confident they are the same, the first specimen was dried out from growing in the sun. Really good sized and firm mushrooms.

The first two photos
By: Alan Rockefeller (Alan Rockefeller)
2018-07-03 07:09:34 PDT (-0700)

Don’t look like the other 3. I think the sequence I got was from the second group.

Created: 2017-07-12 19:29:10 PDT (-0700)
Last modified: 2018-08-18 07:33:06 PDT (-0700)
Viewed: 451 times, last viewed: 2018-10-20 23:19:59 PDT (-0700)
Show Log