Observation 323163: Tylopilus P. Karst.

Notes:
cap 3cm
stem 14cm
found very few spores, 8.8-10.7 × 3.6-4.5

Images

KOH on cap red/orange

Proposed Names

-44% (2)
Recognized by sight
28% (1)
Recognized by sight: In the sense of T. badiceps and X. purpureum this collection resembles
45% (2)
Recognized by sight: See the discussion below
28% (1)
Recognized by sight: overall gestalt
Based on microscopic features: spore measurements

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Huafang,
By: I. G. Safonov (IGSafonov)
2019-12-16 21:22:16 AST (-0400)

I guess we will have a better understanding of what this critter is once ITS sequences of T. badiceps and X. purpureum become available or if your collection is sampled for a phylogenetically informative locus. Even though ITS is not suited well for inter-generic tree building, the overall pattern of characters is often useful to place a mushroom into a genus. In your case, the BLASTn suggests Tylopilus.
Don’t worry about the missing T – it’s a minor technicality that doesn’t really change anything that I said about the ITS sequence. I can try to explain though, if you are interested. :-)

HaHa! I have help nearby now – Alden, thank you.
By: Huafang
2019-12-16 20:33:03 AST (-0400)

Alden uploaded most of my sequences to MO after I met him at University of Michigan. He explained and showed me how to analyze the sequencing result, and how to upload to MO.

Thank you, Igor. For your lengthy explanation why I was WRONG. I read your comment few times so that I understand how you analyze the results. I’m clear why this observation should be Tylopilus not X. purpureum. Although I still don’t understand “the first T is missing, so it would be beneficial to carefully review the chromatograms to weed out additional errors, if any”. Why the first T is important? What the first T means?

Also, the spore measurements…
By: I. G. Safonov (IGSafonov)
2019-12-13 20:36:45 AST (-0400)

…are in excellent agreement with badiceps, but not with purpureum.

ITS sequence
By: I. G. Safonov (IGSafonov)
2019-12-13 20:23:47 AST (-0400)

The full-length nrITS sequence is actually 631 bps long. This locus can be found by searching for the ending motif of nrSSU and the starting motif of nrLSU, GGATCATTA and TTGACCTCAAATCA, respectively. The posted sequence actually ends in the latter (the first T is missing, so it would be beneficial to carefully review the chromatograms to weed out additional errors, if any).
The ITS1 sublocus is 217 bps long and the ITS2 sublocus is 253 bps long. The highly conserved 5.8S region is of the standard length of 161 bps. The ITS subloci can be found by looking for the beginning and ending motifs of 5.8S, ACAACTTTCAGC and CATGCCTGTTTGAGTGTCATTGA, respectively.
As Alden has already mentioned, there are no perfect or similar matches, and percent identities for hits with query lengths of 70-94% are all below 90%. However, the hit list is loaded with accessions of Tylopilus spp.; at the same time there are no accessions of Xanthoconium present in this 100-strong accession output.
BLASTing ITS1 and ITS2 regions separately gives a similar picture in terms of the sequence similarities being under 90% and the heavy presence of Tylopilus spp. accessions. However, for ITS2, there are two unnamed accessions with very high percent identities — KT197671 (75% query cover, 96.9% similar) and KC424573 (52% query cover, 99.3% similar).
A search for the name Xanthoconium purpureum in GenBank led to 6 accessions, none of which unfortunatley are ITS: https://www.ncbi.nlm.nih.gov/.... The same is true for T. badiceps — no ITS accessions in GenBank: https://www.ncbi.nlm.nih.gov/.... If ITS accession for both taxa are in GenBank, they are obviously logged under untraceable names.
According to Bessttes’ BENA, KOH produces no reaction on the cap of X. purpureum, which is not what’s seen here. That and the substantial presence of Tylopilus accessions in the ITS hit lists point away from X. purpureum, IMO.
Lastly, I have recently submitted my suspected T. badiceps colection, obs 373449 for ITS sequencing. I should get results back in a few months.

Great!
By: Alden Dirks (aldendirks)
2019-12-13 18:27:21 AST (-0400)

To be clear, I’m just helping HuaFang upload these sequences as part of the Michigan Mycoflora Project. I didn’t generate these sequences and have only explored them briefly, so your input is very welcome!

Alden,
By: I. G. Safonov (IGSafonov)
2019-12-13 18:24:46 AST (-0400)

Thanks for posting the sequence. I will take a closer look and comment later in the evening.

ITS rDNA 671 nucleotides in length
By: Alden Dirks (aldendirks)
2019-12-13 17:32:36 AST (-0400)

but low query cover (mostly 83% or less) and no close matches in GenBank

Created: 2018-07-16 00:25:28 AST (-0400)
Last modified: 2019-12-16 21:22:17 AST (-0400)
Viewed: 109 times, last viewed: 2019-12-16 22:07:59 AST (-0400)
Show Log