When: 2008-05-04
Collection location: Barton Flats, San Bernardino National Forest, San Bernardino Co., California, USA [Click for map]
Notes:
When I first collected these they seemed to have a slight yellow stain on the base of the stipe and a slightly unpleasant. Unfortunately, I was recovering from a cold so my sense of smell may have been off. I thought I was getting a faint version of the typical phenolic smell and another person on the trip who is familiar with the smell confirmed it. It certainly wasn’t sweet.
The pileus first stained distinctly reddish (see third image), whereas the stipe went orangish yellow at first (see fourth image), then became more reddish and finally turned brown. However, after bringing it home, and cutting open the freshest specimen it only stained red.
The habitat was mixed pine and cedar (Calocedrus decurrens) forest in the San Bernardino mountains near the Santa Ana river. The altitude was around 5700’ (1750m). A snow plant (Sarcodes sanguinea Torrey) was blooming nearby.
Species Lists
Images
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 5.94 | 1 | (nathan) | |||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
0.86 | 28.53% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 5.94 | 1 | (nathan) | |||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
2.57 | 85.60% | |||||||
Comments
Add Comment
I quoted both the latin diagnosis and the English version on the page for Agaricus agrinferous. A full discussion is available in Mycologia, 100(6), 2008, pp. 876–892.
Interestingly the name refers to this being a ‘lowland species’. However, this particular observation was made at about 5700’ in the San Bernardino mountains under a mix of pine and cedar.
Rick Kerrigan provided the following analysis:
“Your material had an ITS DNA sequence that perfectly matched that of A. agrinferous, a species we described a few months ago that used to be known as the ‘lowland’ (or coastal) entity within A. subfloccosus.
Here’s the sequence.
GGAAGGATCATTATTGAATTATGTTTTCTAGATGGGTTGTAGCTGGCTCTTCGGAGCATGTGCACACCTGTTTGGACTT
CATTTTCATCCACCTGTGCACCTTTTGTAGTCTTTTTCAGGTATTGAAGGAAGTGGTCAGCCTATCAGCTCTTTGCTGG
ATGTAAGGACTTGCAGTGTGAAAACAGTGCTGTCCTTTACCTTGACCATGGACTCTTTTTCCTGTTAGAGTCTATGTTA
TTCATTATACTCTTAGAATGTTATTGAATGTCTTTACATGGGCTATGCCTATGAAAATTATTATACAACTTTCAGCAAC
GGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCAT
CGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTATATTCTCAACTCCC
CAATACCTTGTTGTAAAGGAGAGCTTGGATTGTGGAGGTTTGCTGGCCCCTGCTTGGGGTCAGCTCCTCTGAAATGCAT
TAGCGGAACCGTCTGCGATCTGCCACAAGTGTGATAACTTATCTACACTGGCGAGGGGATTGCTTTCTGTGATGTTCAG
CTTCTAATCGTCTAAGGACAAATTCTTGAATGCTGACCTCAAATCA
"
I showed this observation to Rick Kerrigan at the 2008 MSA meeting, and he is no longer confident about using the name A. spissicaulis for non-European material. However, in personal communication he thinks this observation may well match what he reported as A. spissicaulis in 1982 & 1986. I have sent him the dried material (Jan. 2009), so we may know more soon.
MykoWeb mentions A. spissicaulis as occuring in California. I also just noticed the description in Agaricales. For some reason I only saw the group last night. I noticed that both Debbie’s Roger’s Mushrooms link and Index Fungorum say the name is deprecated in favor of A. littoralis (or Agaricus litoralis for the more literal minded… – looks like another r[h]ac[h]odes in the making).
Not familiar with this species, but did a bit of online research. The reddening fits, general stature and veil, also the “off-smell” with age (not necessarily phenolic, but perhaps phenol is a catch-all description for "bad smells in
Agaricus?). Here’s a nice description on Rogersmushrooms
Great sequence of events!
Nice documentation to a new species.