When: 2012-06-04
Collection location: University of Washington, Seattle, King Co., Washington, USA [Click for map]
Who: BlueCanoe
Notes:
Growing near deodar cedar (Cedrus deodara) and pitch pine (Pinus rigida). Pileus somewhat tacky.
Update: Returned the next day and collected both fruiting bodies. Flesh light yellow/orange with a white pith in the center of the stipe. Fresh cut smelled slightly of anise. Larger specimen measured 11 cm tall, cap 8.5 cm wide, stipe 2.5-3.5 cm wide, stipe 9 cm tall. Smaller specimen 9 cm tall, cap 7 cm wide, stipe 2-3 cm wide, stipe 8 cm tall. Spore print underway; specimens will be dried. White balance on photos taken 6/5/12 calibrated using gray card.
Update 2: Spore print is brown (dark gray-brown?). Specimens are dried and available.
Update 3: Returned 25 days later (6/29/12) and found a new, third specimen in the same location.
Species Lists
Images
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 0.00 | 0 | ||||||
| Doubtful | -1.0 | 15.00 | 3 | (BlueCanoe,mycotrope,Alan Rockefeller) | |||||
| Not Likely | -2.0 | 14.97 | 3 | (amanitarita,NMNR,Christian Schwarz) | |||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
-1.45 | -48.37% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 9.84 | 2 | (Alan Rockefeller,mycotrope) | |||||
| Doubtful | -1.0 | 10.02 | 2 | (Christian Schwarz,NMNR) | |||||
| Not Likely | -2.0 | 4.96 | 1 | (amanitarita) | |||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
-0.39 | -13.03% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 5.80 | 1 | (Alan Rockefeller) | |||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 9.84 | 2 | (amanitarita,Christian Schwarz) | |||||
| As If! | -3.0 | 5.70 | 1 | (else) | |||||
| Overall Score sum(score * weight) / (total weight + 1) |
-1.39 | -46.24% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 4.96 | 1 | (amanitarita) | |||||
| Could Be | 1.0 | 19.26 | 4 | (darv,Christian Schwarz,mycotrope,...) | |||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
1.16 | 38.57% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 4.88 | 1 | (Christian Schwarz) | |||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 10.76 | 2 | (amanitarita,Alan Rockefeller) | |||||
| Doubtful | -1.0 | 9.17 | 2 | (NMNR,mycotrope) | |||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
0.63 | 20.96% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 0.00 | 0 | ||||||
| Could Be | 1.0 | 3.56 | 1 | (Stopwhispering) | |||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 10.93 | 2 | (NMNR,Alan Rockefeller) | |||||
| As If! | -3.0 | 9.00 | 2 | (mycotrope,amanitarita) | |||||
| Overall Score sum(score * weight) / (total weight + 1) |
-1.85 | -61.67% | |||||||
| User’s votes are weighted by their contribution to the site (log10 contribution). In addition, the user who created the observation gets an extra vote. | |||||||||
| Vote | Score | Weight | Users | ||||||
|---|---|---|---|---|---|---|---|---|---|
| I’d Call It That | 3.0 | 0.00 | 0 | ||||||
| Promising | 2.0 | 24.50 | 5 | (darv,NMNR,amanitarita,...,...) | |||||
| Could Be | 1.0 | 4.88 | 1 | (Christian Schwarz) | |||||
| Doubtful | -1.0 | 0.00 | 0 | ||||||
| Not Likely | -2.0 | 0.00 | 0 | ||||||
| As If! | -3.0 | 0.00 | 0 | ||||||
| Overall Score sum(score * weight) / (total weight + 1) |
1.77 | 59.11% | |||||||
Comments
Add Comment
BlueCanoe’s Agaricus does indeed resemble this mushroom.
according to the Matchmaker/Smith description, cutting the flesh will also cause the yellow changing to orange color changes.
Get a spore print if you can! Not included in the original description.
spores 7-8.5 x (4.7)5-5.9 microns, elongate, obovate to elliptic in face and side view, apiculus colorless, blunt, guttulation (droplets) obscure; basidia 4-spored, 17.5-24 × 8-9.5 microns, clavate, colorless; cheilocystidia abundant, forming sterile gill edges, 8-38 × 6-15 microns, often ellipsoid to obovate, often with a spherical, septate tip, occasionally cells clavate, spheropedunculate, napiform, or fusoid ventricose to cylindric in shape, often in bud-like catenulations, yellow in KOH, (Isaacs)
I can find only the one photo in MatchMaker, but I can say that it doesn’t look too far off. The size of elwhaensis is quite large (12-35 cm cap diam.). Appears this could fall out at the low end.
macro description sez that gills become “gray-wine” colored at maturity…now that’s rather different for an Agaricus sp!
Yeah, I agree that the gills were the biggest pointer away from Floccularia.
Darv’s got a great lead! That nom prov description, though brief, has some pretty interesting matching characters mentioned (yellow staining beneath/between cuticle).
At this point, even if the fruitbodies are beat up, the gills should be much darker.
If they’re still in decent enough shape to dry them, please do so! I’d love to take a look.
Thanks for the help, everyone!
I left them where I found them, and can easily go back. It’s been pretty rainy since yesterday and I pulled them out of the ground to photograph; we’ll see what shape they’re in. I didn’t try to smell them. Based on memory, cap diameters were in the 6-10 cm range.
eliminates all but Agaricus. Unless that brown on the gills is actually staining and this is a Leucoagaricus? A spore print woulda helped. How big is this?
Did you notice an odor? IF augustus (and I’m not quite buying it, either) there should be a strong almondy odor.
But w/out saving it or refinding it, a specific ID will be tough.
I can see a possibility for Agaricus but it doesn’t look very "Prince"ly to me.
The color is not the main problem for this being Floccularia. The gills are very close and free or very nearly so as far as I can tell, and the edges in closeup look rough like they have cheilocystidia which are absent in F. albolanaripes. Also I’ve never seen such chunky scales and so much marginal veil tissue on that species.
I can see how these could be Agaricus (something like the Prince), and the gills of A. augustus and some of its relatives can stay pale for quite a while. That said, something (I can’t decide what, yet) is ‘off’ for these to be in that genus, at least in my head.
Floccularia are often much yellower, but can also be quite drab. See observation 86135 for specimens similar to these.
Created: 2012-06-04 18:11:01 MDT (-0600)
Last modified: 2018-07-19 17:00:58 MDT (-0600)
Viewed: 529 times, last viewed: 2019-04-14 14:52:38 MDT (-0600)
Show Log
Although this specimen gave me some trouble (PCR didn’t amplify the DNA very well, the resulting sequence was a little dirty), I was able to get enough signal back to compare against the BLASTn database. The ITS1F region brings back a very good match for a couple strains of Agaricus augustus generated by Geml et al.
I looked at the SVIMS descriptions, and really can’t tell how they were distinguishing A. augustus and A. elwhaensis.
ITS1F sequence below:
>Agaricus elwhaensis_BlueCanoe_MO96369_ITS1F
CACGCCTGTTTGGACTTCATTTTCATCCACCTGTGC
ACATATTGTAGTCTTTGGTTGGGTTAGGAGGAAGT
GGTCATCCTATCAGCATCTGCTGGATGTGAGGACTT
GCATTGTGAAAACTTTGCTGTCCTCTATGTGATCATG
GAATCACTTTCTCACCAGAGTCTATGTCATTCATTAT
ACTCTGTCGAATGTCATTGAATGTCTTTACATGGGCT
TGTATGCCTATGAAAATTGTAATACAACTTTCAGCAA
CGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGC
GAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT
GAATCATCGAATCTTTGATTTTTTCTTGCGCTCCTTGGT
ATTCCGAGGAGCTTTCGTGTGGGGAGTGTCATTAAAT
TCTCAACTCTCTTATACTGTTTGGTAGAAGAGAGCTTG
GACTGTGGAGGCTTGCTGGCCACTTGTTGGAGGTCAGC
TCCTCTGAAATGCATTAGCGGAACCGTTTGCGATCTG
CCACAAGTGTGATAAATTATCTACACTGGCGAGGGGAT
TGCTCTCTGTAATGTTCAGCTTCTAATTGTCTCTACTTTG
TGAGACTACTTTTTGAATACTTGACCTCAAATCAGGTAGG
ACTACCCGCTGAACTTAAGCATATCAAT