Observation 109788: Russula Pers.

When: 2012-09-15

Collection location: Mccormick’s Creek State Park, Spencer, Indiana, USA [Click for map]

Who: Stephen Russell (Mycota)

Specimen available

Species Lists

Images

Proposed Names

57% (1)
Recognized by sight
28% (1)
Recognized by sight

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Would you happen to have, and be willing to share,
By: Stephen Russell (Mycota)
2016-08-15 12:21:28 CDT (-0400)

a FASTA file with verified Russula sequences? ITS alone is fine for now. I am going to be looking at most of my Russulas soon, and would be interested in a solid reference.

Here is a verified barcode for R. vinacea to compare against
By: Brian Looney (GibbiPicasso)
2016-08-15 11:51:23 CDT (-0400)

>gi|694190894|gb|KF810139.1| Russula vinacea voucher BPL257 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence
TGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTAAAACTGAG
GCGCGAGGGCTGTCGCTGACCTGAACTCAGGTTGTGCACGTCCGAGCGTCCTCATACATCCATCTCACCC
CTATGTGCACCACCGCGTGGGTCTTCCTTTGGCTCGTCCGAAGGGGGGCTTACGTTTTCACACAAACTTT
GTATGCAGTGTAGAATGTACCTTTGTTTTGCGATCACGCAATTAATACAACTTTCAACAACGGATCTCTT
GGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCAT
CGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAATTC
TCAAAACCCTTTTCTTTTTGGGAGAAGGGTTTTGGACTTGGAGGCCTTTTGCTGGCTTTGCCTTGAAGCC
AGCTCCTCCTAAATGAATTAGTGGGGTCCACTTTGCCGATCCTTGACGTGATAAGATGTTTCTGCGTCTT
GTGGTTTGACACTGTCACCCGCTTCTAATCGTCTCATTGACAATTGATGGTGTTCCGGTCACCACCTCTC
TATGGGGTGGTTGGCTTGACCCACAACATGACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA
AGCATATCATA

Maybe try LSU
By: Alan Rockefeller (Alan Rockefeller)
2016-08-13 03:03:08 CDT (-0400)
Closest ITS matches are unknown Monotropa associates in Russulales
By: Stephen Russell (Mycota)
2016-08-11 22:49:54 CDT (-0400)