Please do not re-click a link while waiting for a page to load. (It’s slower and degrades site speed for all users.)
To get images for machine learning, see MO Images for Machine Learning

 
Observation 144260: Macrolepiota Singer

Images

IMG_5971.JPG
IMG_5956.JPG
IMG_5957.JPG
IMG_5961.JPG
IMG_5964.JPG
IMG_5965.JPG
IMG_5976.JPG
IMG_5992.JPG
Habitat
macrolepiota.JPG
ITS tree
macrolepiota-tree-m.jpg
New ITS tree, with purple dots indicating the sequences which have photos available.

Proposed Names

58% (1)
Recognized by sight
29% (1)
Based on chemical features: ITS sequence is 97% similar to Macrolepiota columbiana

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
What a beautiful image!
By: Judi T. (AvidAmateur)
2016-08-06 20:18:11 MST (-0700)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-12 06:24:01 MST (-0700)

CTTGATGGGTTGTAGCTGGCTCTTCGGAGCAATGTGCACGCCTGTCTTGCTTTTTATTCATCCACCTGTGCACTTTCTGTAGTCTTCTAGGGATTGAGAGCAGCCAATTATCGAGCCTTCTCGGATGTGAGGGATGCTTGCGCGTAAAAGTGTGTAGCTTTCTTCAAATGGCTGTGAACTTTTCCTGGAGTCTATGTTTTCATATACCACATAGTATGTATCAGAATGTATTCAATGGGCCTTTTGTGCCTATAAATGATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCCCCTCCAATTTTGTATTGTGATGGGGCTTGGATATGGAGGTTTGCTGGCCTTTAAAAGGTCAGCTCTTCTGAAATGTATTAGCGGAACCGTTTGCGATCCGTCACAGGTGTGATAATTATCTACACCGTGTGGTCGCTCTCTGTCTGTTCAGCTTCTAATCGTCCTGTCTTCATGGACAATCATTTTGAATATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAG