Observation 15815: Psilocybe allenii Borov., Rockefeller & P.G. Werner

When: 2008-12-28

Collection location: Mountain View, California, USA [Click for map]

Who: Alan Rockefeller (Alan Rockefeller)

No specimen available

Notes:
Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTC
CTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGGAACTGGATAGGAGAGG
GACTTGTCCTTCAAGTTGAAG

Species Lists

Images

33270
33252
33253
33254
33255
33256
33259
33265
33267
33269
33271
33272
33273
33274
33275
33276
33325
33326
33327
33328

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS gene
By: Alan Rockefeller (Alan Rockefeller)
2010-09-28 01:02:44 CDT (-0500)

The ITS gene is being sequenced. Geneious is being used to turn the raw data into nucleotides.

What gene is being sequenced here?
By: Paul Derbyshire (Twizzler)
2010-09-27 00:36:58 CDT (-0500)

And what tools are you using?

Created: 2008-12-29 01:18:05 CST (-0600)
Last modified: 2018-01-30 20:48:54 CST (-0600)
Viewed: 392 times, last viewed: 2018-02-25 00:53:36 CST (-0600)
Show Log