When: 2008-12-28

Collection location: Mountain View, Santa Clara Co., California, USA [Click for map]

Who: Alan Rockefeller (Alan Rockefeller)

No specimen available

Notes:
Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTC
CTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGGAACTGGATAGGAGAGG
GACTTGTCCTTCAAGTTGAAG

Species Lists

Images

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS gene
By: Alan Rockefeller (Alan Rockefeller)
2010-09-28 11:32:44 IST (+0530)

The ITS gene is being sequenced. Geneious is being used to turn the raw data into nucleotides.

What gene is being sequenced here?
By: Paul Derbyshire (Twizzler)
2010-09-27 11:06:58 IST (+0530)

And what tools are you using?