Observation 161869: Inocybe stellata E. Horak, Matheny & Desjardin

Notes:
DNA match with DED8060 http://www.ncbi.nlm.nih.gov/nuccore/GQ893010.1

Collected by মোঃ ইকবাল হোসেন (Md Iqbal Hossain)
ITS sequence: TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAATAAACTTGAACAGGCTGTTG
CTGGCCCCTCTGTGGGTATGTGCACGCTTGTCATCTTTATTTCTCCAACTGTGCACATAATTGTAGAC
TCTATAGAAAGCTTTTATTGGTTTAACAATAGATTGAGGATTAGTTCAAACTTTTCCTTGGACTTTCT
AGGTCTATGTTATTTTCATAAACCATGAAATGTGTTTTAGAATGTTGTAAATTTGAAAATGTATACAA
CTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA
ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCCTGGTATTCCTAGGAGCAT
GCCTGTTTGAGTGTCATTAAAATCTCAACCACAAGCTTGCTTGTGGATTGGATTATGGGAGTTTTTTT
GCAGGCTTTTAACAAAGTTGGCTCTCCTGAAATGCATTAGTAGTATCTGAGCAGACTACAGGTGTTGA
TAAATATTTTTTACACTTGAAGTTAGACTGCTATAACAGATTAGACTGCTTCAAAC

Species Lists

Images

410547
IMG_4692.JPG
Pleurocystidia 400x
410537
IMG_4682.JPG
Cheilocystidia 200x
410538
IMG_4683.JPG
Cheilocystidia 400x
410539
IMG_4684.JPG
Cheilocystidia 400x
410540
IMG_4685.JPG
Cheilocystidia 400x
410541
IMG_4686.JPG
Cheilocystidia 400x
410542
IMG_4687.JPG
Cheilocystidia 400x
410543
IMG_4688.JPG
Cheilocystidia 400x
410544
IMG_4689.JPG
Spores 400x
410545
IMG_4690.JPG
Spores 400x
410546
IMG_4691.JPG
Basidia 400x
410548
IMG_4693.JPG
Pleurocystidia 400x
410549
IMG_4694.JPG
Pleurocystidia 400x
410550
IMG_4696.JPG
Pleurocystidia 400x
410551
IMG_4697.JPG
Pleurocystidia 400x
410552
IMG_4701.JPG
Spores 1000x
416641
IMG_3773.JPG
416642
IMG_3775.JPG
416643
IMG_3777.JPG

Proposed Names

29% (1)
Recognized by sight
87% (1)
Eye3 Eyes3
Based on microscopic features
Based on chemical features: 100% GenBank match with https://www.ncbi.nlm.nih.gov/nucleotide/GQ893010.1

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
nice micro…
By: Richard Kneal (bloodworm)
2014-03-22 14:51:35 CDT (-0400)

unreal!!

Seems
By: Irene Andersson (irenea)
2014-03-22 13:09:38 CDT (-0400)

not too different from Inocybe calospora – AM882759

Created: 2014-03-22 09:43:15 CDT (-0400)
Last modified: 2018-02-05 23:44:42 CST (-0500)
Viewed: 88 times, last viewed: 2018-04-10 03:02:30 CDT (-0400)
Show Log