Observation 162079: Penicillium melinii Thom

Notes:
Collection # O-77, cultured by Alex Smith.

Species Lists

Images

IMG_4964.JPG
IMG_4963.JPG
IMG_4970.JPG
600x in water
IMG_4971.JPG
600x in water
IMG_4973.JPG
200x in lactoglycerol
IMG_4974.JPG
600x in lactoglycerol
IMG_4975.JPG
600x in lactoglycerol
IMG_4976.JPG
600x in lactoglycerol

Proposed Names

29% (1)
Recognized by sight
58% (1)
Based on chemical features: Closest ITS match

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-11-21 11:48:07 CST (-0500)

GATTGATTGTTGTCGGCAAGCGCCGGCCGGGCCTACAAGAGCGGAAGACGAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAAGGAGGACGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTTAGCTAATTGCTCAGACTGCAATCTTCAGACAGCGTTCAATGGTGTCTTCGGCGGGCGCGGGCCAGAGGGCAAAAGCCCCCCGGCGGCCGTGAGGCGGGCCCGCCGAAGCAACAAGGTACGATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTA