Notes:
Collected in the Rim Fire area on burnt ground. The ITS sequence (below) is a perfect match to the type Tricharina praecox var praecox except for the beginning of the beginning of the sequence that may be in error.

ITS: TCTTGGTCAATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAAGTAAATATGTATTCTCTGGAATATACGTTTCAAACCCATCTGTGTATCTTACCTGTTGCTTCCGTACCGCGTGGACTTCGGTCCCCTCATGCTGTACTTCGGTACGGTTCCAGAGTGCCGGTGCGGAAGGTATACATCAAACTCTTGCATTCCATGTCTTCTGTCTGAACTGTTAATAACAAAAGTTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAAAAACCACTCAAGCTCTTTTGCTTGGTCATGGAAGAAGAGTCCGCTTGCCGGTCTCCCTTTCGAAATGCAATGGCGGAAGGTCTCTTGTACCCAGCGTAGTAATAACTTTTCGCTTTGTGCATTGATTCATTCCTGCCGTCAAACCCCCAATTTTCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

Species Lists

Images

Spores 16-17.6 X 8.3-9.8

Proposed Names

83% (1)
Based on microscopic features: spores and paraphyses match
Based on chemical features: ITS sequence

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-04-10 17:39:25 CDT (-0500)
Last modified: 2014-04-10 17:43:58 CDT (-0500)
Viewed: 83 times, last viewed: 2019-07-12 06:17:53 CDT (-0500)
Show Log