Notes:
Growing in an area burned by the rim fire. Thousands of fruit bodies seen, all were near Abies concolor.

ITS sequence:

CGAGGTCAATTATGTATGGTGGATGCTAGGCCACGAGGGTCCTGAAGAGGACTCCAATTTACGCCCGCAACTGCGACCGGTGTGCCATCGGCGTATGGAGAAAGGTGAGCATTTTACTGCAAGCCTATATATCCCATAACTCCACGGTTGATGGCCTCGGTGCTGTCGCATCTGGAGGCGGGTCTACGTCTATTTAGGACATTGGGAAACTAATTGCCAATCGCTATCCCATTAGGCCAAAACCCCCCAACGATAGTAATCAAACCCGAAGGGGGAGGAGGTTTTTATGACGCTCGAACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGTGGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTTTTTTTGTTTTTGTAATTCTGACGTCTGTTTGTTCACAAAGAGTTTTGGTTGTTGTTCCTCCCCCCAGCGAGGTGCCGGGGGAAGCAAGGTGGGACAGGTACGCAGAGGGTTTAGATGGGGGCTGCCCCGGGTTCCTGGCAGGCCGTTCAACAACGTAAAGCTACTAGGCCTGCCGGCCCCCACAGGGCGGGGCCCTTTTCTGTGTGGTTCTTGGTAATGATCCTTCCGCAGGTTCACCTACGGAAG

LSU consensus sequence (two fruit bodies sequenced with 5.8sr and LR7 primers)

GGTGGTAGGAAGATAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGATCTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGCAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTTCTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTTGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCTCGCCGCCACGGTAGMAACGATGCCGTGGCGAGTAGGCAGGCGTGGGGGTCAGTGACGAAGCCTTGGGAGTGATCCCGGGTCGAACGGCCCCTAGTGCAGATCTTGGTGGTAGTAANNACGTCACAGAGGGTGAGAATCCCGTGCTTGGCTGGCTGTCCCCGTCCATGTGAGGTGTCTTCSACSAGTCSAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAANATGAAAAGCACTTTGAAAATAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAGACCAGACTTCGGTAGGGGGTGATCAGCCGTGCTTCNNCGCGGTGCACTTGTTCCTCTCCGGGNCAGCATCNNTTGAGGCGGCGGGATAAAGGTCCCGGGAATGTGGCTCCNTCACGGGAGTGTTATAGCCCGGGNTGAATGCCGCCA

Species Lists

Images

419398-2.jpg
edited with Photoshop
IMG_5815.JPG
IMG_5809.JPG
IMG_5816.JPG
IMG_5794.JPG
IMG_5793.JPG
IMG_5790.JPG
IMG_5791.JPG
IMG_5787.JPG
IMG_5781.JPG

Proposed Names

92% (2)
Based on chemical features: 100% ITS match

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
GenBank MF417455
By: Alan Rockefeller (Alan Rockefeller)
2017-08-10 16:47:57 CEST (+0200)
LSU & ITS sequences added
By: Alan Rockefeller (Alan Rockefeller)
2014-06-21 16:34:08 CEST (+0200)
superb/elegant
By: Keith Buckley (zorel)
2014-05-09 09:27:10 CEST (+0200)

A unique look at the precious fruit during it’s early development.

Created: 2014-05-09 05:22:24 CEST (+0200)
Last modified: 2018-02-06 05:48:09 CET (+0100)
Viewed: 905 times, last viewed: 2019-07-13 06:31:33 CEST (+0200)
Show Log