Notes:
Herbarium_Specimen(s): UBC F29533
GenBank_#: Sequence is in the Comment from Christian Schwarz below 2018-07-19
Original_Herbarium_Label: Boletus truncatus (Singer, Snell & E.A. Dick) Pouzar
Syn.: Xerocomellus truncatus (Singer, Snell & E.A. Dick) Klofac
Xerocomellus diffractus N. Siegel, J.L. Frank & C.F. Schwarz nom. prov.
Location: Canada, British Columbia, Victoria, Observatory Hill
Other:
Spores: 15-17(-18) x 5-6 µm, few spores truncate, but not too obviously
Part of the specimen was sent to Christian Schwarz on May 29, 2014, but we have not heard from Christian yet (2014-08-17), if he got it.

Species Lists

Images

IMG_5502a.jpg

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
DNA sequence
By: Christian (Christian Schwarz)
2018-07-19 14:59:37 PDT (-0700)

>CSALVA 102_Xerocomellus sp._17 Oct 2008-Observatory Hill, British Columbia, Canada-Adolf and Oluna
TTGAGGTCAGTTGTCAGGAAGACGAGGGANCGGAGCCAGCCTTGCGTTCGTCGGCCTCACGACCAACTAGTAGCTAAAGCTTCGCAAGTCCCAAGTCAAGGATTGGAAGCAAACAGACTCATTCATGCTCGTCCAATGCTCCAGCGACGACGATCATTATCACGTCAAGGCCGTGCACATCAGACTTGCTGTCCATTGCTAATGCATTTCAGGAGAGCCGACAGCTTTCGCCGCCAGCAACCCCAAAGTCCAAGCCATGCCTCAAAATCAATCAAGACATGGTTGAGAATTCAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAAAATCTGCAATTCACATTACTTATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATTTATTTATTTGACCGCCGCCCGACCGCAAAGTCGGTCGACGATCGTGATACATTCTAGACATACGATGTGTGTGATGATAAAGACATAGATCCTCTTTCGAGGACCTACAATGTGTGCACAGGTGTGAGAGTAAGAGAAAGGTCGACGAAAAGGAAGACGTGCACATGCTTCCCAGTGGAAGCCAGCGACAGTCTCCCCCCTCCATCTTCCCCCCTCGAAATTCGATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCAAGA

1/2 of the sporocarp sent
By: Oluna & Adolf Ceska (aceska@telus.net)
2014-06-02 01:33:49 PDT (-0700)

We mailed you 1/2 of one of the sporocarps in the collection on Thursday, May 29.

I’d like to request a part of the specimen
By: Christian (Christian Schwarz)
2014-05-28 14:21:35 PDT (-0700)

if you’d be willing, we’d like to sequence it and compare it
to the darker-capped, red-stiped CA varieties.

The cap texture of this observation reminds me more of Xerocomellus zelleri, but
the stipe and cap are still extremely pale for that species.

The stipe is overexposed
By: Oluna & Adolf Ceska (aceska@telus.net)
2014-05-28 13:32:50 PDT (-0700)

and my correction did not work.
Spores were large and some were truncated. Adolf
P.S. I posted it as an illustration to Oluna’s herbarium specimen. I am preparing them for accessioning into the UBC herbarium.

Did you actually look at the spores?
By: Christian (Christian Schwarz)
2014-05-28 10:10:18 PDT (-0700)

The cap and stipe colors seem very off
for the B./X.truncatus group.

Created: 2014-05-28 09:16:23 PDT (-0700)
Last modified: 2018-07-19 22:26:55 PDT (-0700)
Viewed: 95 times, last viewed: 2019-07-13 10:45:16 PDT (-0700)
Show Log