Notes:
Re: http://www.instructables.com/id/Backyard-Forensics/

ITS sequence:

TCCACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGAGCCTGCCTTTTGGCTGCCGGGGGACGTCTGTCCCCGGGTCCGCGCTCGCCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGACTGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA

Species Lists

Images

IMG_5974.JPG
penicillium-tree.jpg
IMG_5973.JPG
IMG_5975.JPG
IMG_5977.JPG
Penicillium.jpg
A better phylogenetic tree

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
Published in Biocoder 6
By: Alan Rockefeller (Alan Rockefeller)
2018-02-24 16:08:45 CST (-0500)

Cataloging Strains:Isolation and Identification of Invasive Fungi on Citrus limon

Page 11

http://www.oreilly.com/...

Created: 2014-06-18 07:45:09 CDT (-0400)
Last modified: 2018-03-08 23:08:41 CST (-0500)
Viewed: 148 times, last viewed: 2019-07-14 07:42:54 CDT (-0400)
Show Log