When: 2014-06-28

Collection location: Gainesville, Florida, USA [Click for map]

Who: Richard Kneal (bloodworm)

Specimen available

Notes:
fruiting from sandy soil.
no dung present.

spore range = 9.55-11.16 × 6.21-9.38 spore avg. = 10.37 × 8.07

ITS:
TCGAATAAACTAGGTAGACGCTGTTGCTGTCCCTCTCGGGGGAATCTTGTGCACGCATCTGCCTTTTTTGTTTATCCACCTGTGCACACACTGTAGGTCTGGGGGAAGTCTTGTAAGGGAGGTAACTCTCTGAAGGGCTTCATTCATTCCCAGGTCCTATGTATTTTTACATATACACTATAGAAAGTAACAGAACGAATCAATGGGCATTAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGATGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCATCACTTTTGTGATGATGGCTTGGATGTGGAGGTTTTCTGCAGGCTGTCAAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGTGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGGTTTAAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCTGTTATTGGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGC

Species Lists

Images

Proposed Names

51% (4)
Recognized by sight
3% (2)
Based on microscopic features: 2-spored basidia.
18% (3)
Recognized by sight
Based on microscopic features: 2-spored basidia, spore size and green metuloids.
53% (4)
Recognized by sight: DNA studies indicate that Copelandia should be a separate genus from Panaeolus
Based on microscopic features: Green metuloid cystidia, spore size

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
delay…
By: Richard Kneal (bloodworm)
2014-07-01 05:59:34 PDT (-0700)

Sorry about the delay fellas…
I’ll look at this more tonight.
I haven’t been feeling 100% the past couple days.

NEIN
By: Rocky Houghtby
2014-06-29 13:19:05 PDT (-0700)

Get your sorry ass, dirty underwear and all back in front of the microscope dammit. Don’t forget to taste it.

can i…
By: Richard Kneal (bloodworm)
2014-06-29 10:01:31 PDT (-0700)

change my underwear Byrain?

Basidia?
By: Byrain
2014-06-29 09:48:59 PDT (-0700)

Spore size?

Created: 2014-06-28 16:26:35 PDT (-0700)
Last modified: 2018-11-27 18:10:04 PST (-0800)
Viewed: 568 times, last viewed: 2019-10-14 14:37:27 PDT (-0700)
Show Log