Notes:
Growing on hardwood near the big river below San Augustine.

Species Lists

Images

IMG_9048.JPG
IMG_9044.JPG
IMG_9045.JPG
IMG_9049.JPG
IMG_9050.JPG
IMG_9051.JPG
IMG_9054.JPG
IMG_9055.JPG
polyporus.arcularius.tree.jpg

Proposed Names

Please login to propose your own names and vote on existing names.

= Observer’s choice
= Current consensus

Comments

Add Comment
i
By: Chaelthomas (Chaelthomas)
2019-12-10 02:16:46 PST (-0800)

think i also have L. tricholoma from puerto rico if you want to try those samples together.

i have
By: Chaelthomas (Chaelthomas)
2019-12-09 23:11:19 PST (-0800)

a taiwanese sample

I see three clades of Polyporus arcularius
By: Alan Rockefeller (Alan Rockefeller)
2016-05-05 15:37:29 PDT (-0700)

Two have worldwide distribution and one is just in Asia. Which one is sensu stricto?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-05 12:27:52 PDT (-0700)

ACGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGTTTCAGGAGCTTCGAAGCGAGTGCTTAACCGCTCTCGCCGAGTTGTTACTGGGCCTACGTTTATCACAAACTCTTAAAGTATCAGAATGTAAACGCGTCTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTAACAAGTTCTTAACGGGACTTGCTTAGGCTTGGACTTGGAGGCTTGTCGGCTGCTTRGCAGTCGGCTCCTCTCAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTCACGGTGTGATAATTATCTGCGCCGCGACCGTTGAAGCGTTTAATGGCCAGCTTCTAATCGTCTCTTGCGAGACAGCTTTCATCGAACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Ah ok
By: Elsa (pinknailsgirl)
2014-08-05 17:37:40 PDT (-0700)

now I got the point, thanks.

According to my DNA analysis
By: Alan Rockefeller (Alan Rockefeller)
2014-08-05 17:21:01 PDT (-0700)

of the sequences in Genbank, Polyporus arcularius from Costa Rica is the same as that from the USA, however the European sequences are different. Since Polyporus arcularius is a name from Europe, it probably can’t be applied in North America.

Since Polyporus tricholoma is a name from Cuba, it is more likely to be the correct species for this observation.

Polyporus arcularius
By: Elsa (pinknailsgirl)
2014-08-05 16:52:32 PDT (-0700)

is widely distributed in North America.

I think Polyporus arcularius is a European species
By: Alan Rockefeller (Alan Rockefeller)
2014-08-04 07:39:47 PDT (-0700)

Not sure if we get it in North America. I collected this so I could sequence it and find out.

Why not P. arcularius?
By: Elsa (pinknailsgirl)
2014-08-04 02:32:30 PDT (-0700)